分離済み変異体

tm1866

Allele Nametm1866
BalanceNot Required
OutCrossNot Accepted
Sequence NameF25H2.13
Gene Namertel-1
Worm BaseAllele Name tm1866
Gene Name rtel-1
Sequence F25H2.13
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. W.B. Derry: normal germline apoptosis. Dr. H. Sawa: non Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 38612/38613-39958/39959 (1346 bp deletion)
ChromosomeI
Putative gene structurejoin(38123..38508, 38787..38929, 38975..39062, 39111..39540, 39588..39848, 40325..40533, 40580..40940, 41450..41638, 41688..41936, 41985..42203, Z83224.1:244..417, Z83224.1:466..534, Z83224.1:585..714, Z83224.1:769..845)
Map position5.06
Balancer
Map position of balancer
Sequence of primersIntRev:ACCGAGATGTGGGTTACTGT,ExtRev:AGGGCCGCGCAAAAAAGGCA,IntFwd:AGTATGCCGCCGAAAGCTTC,ExtFwd:CCTGTGTGGTGTGTGATTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dello Stritto MR, Vojtassakova N, Velkova M, Hamminger P, Ulm P, Jantsch V.
The topoisomerase 3 zinc finger domain cooperates with the RMI1 scaffold to promote stable association of the BTR complex to recombination intermediates in the Caenorhabditis elegans germline.
Nucleic Acids Res 2022 50(10) 5652-5671 
[ PubMed ID = 35639927 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621 
[ PubMed ID = 32414869 ] [ RRC reference ]

Bellelli R, Youds J, Borel V, Svendsen J, Pavicic-Kaltenbrunner V, Boulton SJ.
Synthetic Lethality between DNA Polymerase Epsilon and RTEL1 in Metazoan DNA Replication.
Cell Rep 2020 31(8) 107675 
[ PubMed ID = 32460026 ] [ RRC reference ]

León-Ortiz AM, Panier S, Sarek G, Vannier JB, Patel H, Campbell PJ, Boulton SJ.
A Distinct Class of Genome Rearrangements Driven by Heterologous Recombination.
Mol Cell 2018 69(2) 292-305.e6 
[ PubMed ID = 29351848 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Deshong AJ, Ye AL, Lamelza P, Bhalla N.
A quality control mechanism coordinates meiotic prophase events to promote crossover assurance.
PLoS Genet 2014 10(4) e1004291 
[ PubMed ID = 24762417 ] [ RRC reference ]

Johnson NM, Lemmens BB, Tijsterman M.
A role for the malignant brain tumour (MBT) domain protein LIN-61 in DNA double-strand break repair by homologous recombination.
PLoS Genet 2013 9(3) e1003339 
[ PubMed ID = 23505385 ] [ RRC reference ]

Rosu S, Libuda DE, Villeneuve AM.
Robust crossover assurance and regulated interhomolog access maintain meiotic crossover number.
Science 2011 334(6060) 1286-9 
[ PubMed ID = 22144627 ] [ RRC reference ]

Youds JL, Mets DG, McIlwraith MJ, Martin JS, Ward JD, ONeil NJ, Rose AM, West SC, Meyer BJ, Boulton SJ.
RTEL-1 enforces meiotic crossover interference and homeostasis.
Science 2010 327(5970) 1254-8 
[ PubMed ID = 20203049 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol Cell 2010 37(2) 259-72 
[ PubMed ID = 20122407 ] [ RRC reference ]

Mitani S.
Nematode, an experimental animal in the national BioResource project.
Exp Anim 2009 58(4) 351-6 
[ PubMed ID = 19654432 ] [ RRC reference ]

Barber LJ, Youds JL, Ward JD, McIlwraith MJ, O'Neil NJ, Petalcorin MI, Martin JS, Collis SJ, Cantor SB, Auclair M, Tissenbaum H, West SC, Rose AM, Boulton SJ.
RTEL1 maintains genomic stability by suppressing homologous recombination.
Cell 2008 135(2) 261-71 
[ PubMed ID = 18957201 ] [ RRC reference ]

Gilchrist EJ, O'Neil NJ, Rose AM, Zetka MC, Haughn GW.
TILLING is an effective reverse genetics technique for Caenorhabditis elegans.
BMC Genomics 2006 7 262 
[ PubMed ID = 17049087 ] [ RRC reference ]