| Allele Name | tm1865 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F46F6.1 |
| Gene Name | rme-4 |
| Worm Base | Allele Name |
tm1865
|
| Gene Name |
rme-4
|
| Sequence |
F46F6.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. K. Sato: EMBO J, 27, 1183 (2008). |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| [Y49A10A] 21927/21928-[Y49A10A] 22375/22376 (448 bp deletion) |
| Chromosome | X |
| Putative gene structure | [Y49A10A] complement(join(21169..21574, 22138..22304, 22349..22405)) |
| Map position | 1.98 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CGTCGCAAATGGGTCGGCAA,ExtFwd:GGACCGATGAGCCAGGAATC,IntRev:CCCGAGTCTCTCGTCGACAT,ExtRev:AACTCAATGATGAGGACGCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Haley R, Wang Y, Zhou Z. The small GTPase RAB-35 defines a third pathway that is required for the recognition and degradation of apoptotic cells. PLoS Genet 2018 14(8) e1007558
[ PubMed ID = 30138370 ]
[ RRC reference ]
|
Sato M, Sato K, Liou W, Pant S, Harada A, Grant BD. Regulation of endocytic recycling by C. elegans Rab35 and its regulator RME-4, a coated-pit protein. EMBO J 2008 27(8) 1183-96
[ PubMed ID = 18354496 ]
[ RRC reference ]
|
|