| Allele Name | tm1864 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y73F8A.21 |
| Gene Name | nhr-5 |
| Worm Base | Allele Name |
tm1864
|
| Gene Name |
nhr-5
|
| Sequence |
Y73F8A.21
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 174954/174955-175665/175666 (711 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(173996..174065, 174114..174175, 174633..174771, 174995..175057, 175491..175663, 175728..175994, 176826..176974, 177724..177997, 178481..178702, 178987..179097, 180146..180293, 180462..180734, 181408..181445, 181492..181614) |
| Map position | 13.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TATGTCTTCTGGCGGTAACA,IntFwd:GGGAGTAGCAATGTGATTAC,ExtRev:GTAATGAATGGAGAGCGCTT,IntRev:ATTACCTTATCCTGAGGCGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13
[ PubMed ID = 39951337 ]
[ RRC reference ]
|
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.