分離済み変異体

tm1857

Allele Name

tm1857

Allele Type

通常株

Sequence Name

Y45G5AM.8

Gene Name

WBGene00021560

Worm Base

Allele Name

tm1857

Gene Name

WBGene00021560

Sequence

Y45G5AM.8

Phenotype

homozygous viable. Dr. B. Meyer: Genes & Dev. 23, 1763 (2009).

Mutation site

29739/29740-AAGAAACC-30567/30568 (828 bp deletion + 8 bp insertion)

Chromosome

Putative gene structure

complement(join(25247..25365, 25415..25518, 26657..26767, 26816..26920, 27539..27879, 27933..28112, 29083..29359, 30009..30169, 30222..30388, 30443..30645, 30691..30752))

Map position

-6.23

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TAAAGCAATTCCCCCTAGAC,IntFwd:TTCCCCCTAGACATACGATT,ExtRev:GTTCGAAGCTACGCGGCACA,IntRev:TACGCGGCACACATGGGTCT

Distributed lab

Dr. Michael Jantsch(2005/6),Dr. Barbara J. Meyer(2009/3),Dr. Wei Wei(2022/3),Ofer Rog(2023/6)

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Gordon SG, Rodriguez AA, Gu Y, Corbett KD, Lee CF, Rog O.
The synaptonemal complex aligns meiotic chromosomes by wetting.
Sci Adv 2025 11(9) eadt5675
[ PubMed ID = 40009663 ] [ RRC reference ]

Gordon SG, Rodriguez AA, Gu Y, Corbett KD, Lee CF, Rog O.
The synaptonemal complex aligns meiotic chromosomes by wetting.
bioRxiv 2024
[ PubMed ID = 39149313 ] [ RRC reference ]

Castellano-Pozo M, Sioutas G, Barroso C, Prince JP, Lopez-Jimenez P, Davy J, Jaso-Tamame AL, Crawley O, Shao N, Page J, Martinez-Perez E.
The kleisin subunit controls the function of C. elegans meiotic cohesins by determining the mode of DNA binding and differential regulation by SCC-2 and WAPL-1.
Elife 2023 12
[ PubMed ID = 37650378 ] [ RRC reference ]

Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K.
A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes.
EMBO J 2023 42(11) e105002
[ PubMed ID = 37078421 ] [ RRC reference ]

Castellano-Pozo M, Pacheco S, Sioutas G, Jaso-Tamame AL, Dore MH, Karimi MM, Martinez-Perez E.
Surveillance of cohesin-supported chromosome structure controls meiotic progression.
Nat Commun 2020 11(1) 4345
[ PubMed ID = 32859945 ] [ RRC reference ]

Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM.
Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops.
PLoS Biol 2020 18(8) e3000817
[ PubMed ID = 32813728 ] [ RRC reference ]

Bowman R, Balukof N, Ford T, Smolikove S.
A Novel Role for α-Importins and Akirin in Establishment of Meiotic Sister Chromatid Cohesion in Caenorhabditis elegans.
Genetics 2019 211(2) 617-635
[ PubMed ID = 30563860 ] [ RRC reference ]

Billmyre KK, Doebley AL, Spichal M, Heestand B, Belicard T, Sato-Carlton A, Flibotte S, Simon M, Gnazzo M, Skop A, Moerman D, Carlton PM, Sarkies P, Ahmed S.
The meiotic phosphatase GSP-2/PP1 promotes germline immortality and small RNA-mediated genome silencing.
PLoS Genet 2019 15(3) e1008004
[ PubMed ID = 30921322 ] [ RRC reference ]

Hernandez MR, Davis MB, Jiang J, Brouhard EA, Severson AF, Csankovszki G.
Condensin I protects meiotic cohesin from WAPL-1 mediated removal.
PLoS Genet 2018 14(5) e1007382
[ PubMed ID = 29768402 ] [ RRC reference ]

Crawley O, Barroso C, Testori S, Ferrandiz N, Silva N, Castellano-Pozo M, Jaso-Tamame AL, Martinez-Perez E.
Cohesin-interacting protein WAPL-1 regulates meiotic chromosome structure and cohesion by antagonizing specific cohesin complexes.
Elife 2016 5 e10851
[ PubMed ID = 26841696 ] [ RRC reference ]

Rog O, Köhler S, Dernburg AF.
The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors.
Elife 2017 6
[ PubMed ID = 28045371 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol 2012 10(8) e1001378
[ PubMed ID = 22927794 ] [ RRC reference ]

Severson AF, Meyer BJ.
Divergent kleisin subunits of cohesin specify mechanisms to tether and release meiotic chromosomes.
Elife 2014 3 e03467
[ PubMed ID = 25171895 ] [ RRC reference ]

Severson AF, Ling L, van Zuylen V, Meyer BJ.
The axial element protein HTP-3 promotes cohesin loading and meiotic axis assembly in C. elegans to implement the meiotic program of chromosome segregation.
Genes Dev 2009 23(15) 1763-78
[ PubMed ID = 19574299 ] [ RRC reference ]