| Allele Name | tm1851 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C11D2.6 |
| Gene Name | unc-77 |
| Worm Base | Allele Name |
tm1851
|
| Gene Name |
unc-77
|
| Sequence |
C11D2.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 19547/19548-20760/20761 (1213 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(9594..9704, 9753..9860, 9979..10065, 10472..10543, 10620..11013, 12018..12291, 12464..12599, 13169..13262, 13312..13468, 14178..15021, 15656..15833, 15935..16029, 16078..16209, 16638..16953, 17546..17728, 18097..18198, 18395..18515, 18724..18821, 18900..19078, 19273..19410, 19930..20424, 20672..21168, 21852..21967, 22050..22191, 22238..22337, 22619..22753, 22891..22955, 23402..23557, 25028..25088)) |
| Map position | 3.05 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:TGGAGGTTACGAATGTCCTG,ExtFwd:ACTCGAAGTCTCCATGGAAG,IntFwd:CGAACAGGGAGAGCACAATC,ExtRev:CTGGCGATTCCTGATACAAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Yue X, Zhao J, Li X, Fan Y, Duan D, Zhang X, Zou W, Sheng Y, Zhang T, Yang Q, Luo J, Duan S, Xiao R, Kang L.
TMC Proteins Modulate Egg Laying and Membrane Excitability through a Background Leak Conductance in C. elegans.
Neuron 2018 97(3) 571-585.e5
[ PubMed ID = 29395910 ]
[ RRC reference ]
|
Speca DJ, Chihara D, Ashique AM, Bowers MS, Pierce-Shimomura JT, Lee J, Rabbee N, Speed TP, Gularte RJ, Chitwood J, Medrano JF, Liao M, Sonner JM, Eger EI 2nd, Peterson AS, McIntire SL.
Conserved role of unc-79 in ethanol responses in lightweight mutant mice.
PLoS Genet 2010 6(8)
[ PubMed ID = 20714347 ]
[ RRC reference ]
|
Humphrey JA, Hamming KS, Thacker CM, Scott RL, Sedensky MM, Snutch TP, Morgan PG, Nash HA.
A putative cation channel and its novel regulator: cross-species conservation of effects on general anesthesia.
Curr Biol 2007 17(7) 624-9
[ PubMed ID = 17350263 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.