分離済み変異体

tm1846

Allele Nametm1846
BalanceNot Required
OutCrossNot Accepted
Sequence NameF01E11.5
Gene Nametyra-2
Worm BaseAllele Name tm1846
Gene Name tyra-2
Sequence F01E11.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. R. Horvitz: normal serotonin resistance. Dr. K. Ashrafi: Cell Metab 8, 118 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36937/36938-37356/37357 (419 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(32555..32635,32688..32799,32847..32978, 33033..33223, 33270..33370, 34314..34413, 36372..36566, 36613..36800, 37061..37181, 37230..37475))
Map position-1.93
Balancer
Map position of balancer
Sequence of primersExtFwd:GTGCTCTATAGCTATGGGGA,IntFwd:TACATGAGACGAGACGGCCA,ExtRev:GTCGACAACATGGGAGTTGA,IntRev:GCAGTCCCGGATTTTATTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215 
[ PubMed ID = 40224011 ] [ RRC reference ]

Kramer TS, Wan FK, Pugliese SM, Atanas AA, Hiser AW, Luo J, Bueno E, Flavell SW.
Neural Sequences Underlying Directed Turning in C. elegans.
bioRxiv 2024   
[ PubMed ID = 39149398 ] [ RRC reference ]

Riedl J, Fieseler C, Zimmer M.
Tyraminergic corollary discharge filters reafferent perception in a chemosensory neuron.
Curr Biol 2022 32(14) 3048-3058.e6 
[ PubMed ID = 35690069 ] [ RRC reference ]

De Rosa MJ, Veuthey T, Florman J, Grant J, Blanco MG, Andersen N, Donnelly J, Rayes D, Alkema MJ.
The flight response impairs cytoprotective mechanisms by activating the insulin pathway.
Nature 2019 573(7772) 135-138 
[ PubMed ID = 31462774 ] [ RRC reference ]

Chute CD, DiLoreto EM, Zhang YK, Reilly DK, Rayes D, Coyle VL, Choi HJ, Alkema MJ, Schroeder FC, Srinivasan J.
Co-option of neurotransmitter signaling for inter-organismal communication in C. elegans.
Nat Commun 2019 10(1) 3186 
[ PubMed ID = 31320626 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Fu J, Zhang H, Huang W, Zhu X, Sheng Y, Song E, Xu T.
AIM interneurons mediate feeding suppression through the TYRA-2 receptor in C. elegans.
Biophys Rep 2018 4(1) 17-24 
[ PubMed ID = 29577066 ] [ RRC reference ]

Law W, Wuescher LM, Ortega A, Hapiak VM, Komuniecki PR, Komuniecki R.
Heterologous Expression in Remodeled C. elegans: A Platform for Monoaminergic Agonist Identification and Anthelmintic Screening.
PLoS Pathog 2015 11(4) e1004794 
[ PubMed ID = 25928899 ] [ RRC reference ]

Noble T, Stieglitz J, Srinivasan S.
An integrated serotonin and octopamine neuronal circuit directs the release of an endocrine signal to control C. elegans body fat.
Cell Metab 2013 18(5) 672-84 
[ PubMed ID = 24120942 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc Natl Acad Sci U S A 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]

Wragg RT, Hapiak V, Miller SB, Harris GP, Gray J, Komuniecki PR, Komuniecki RW.
Tyramine and octopamine independently inhibit serotonin-stimulated aversive behaviors in Caenorhabditis elegans through two novel amine receptors.
J Neurosci 2007 27(49) 13402-12 
[ PubMed ID = 18057198 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]