| Allele Name | tm1845 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0240.4 |
| Gene Name | npp-22 |
| Worm Base | Allele Name |
tm1845
(x1) |
| Gene Name |
npp-22
|
| Sequence |
B0240.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. V. Cordes: J.C.Biol. 173, 509-519 (2006) |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15119/15120-GTCAACATAAAATGGTACAGCTGCTCCTTTAACTCCTTTTCCAATGATAGAAGGTAAAGAACATACT-16104/16105 (985 bp deletion + 67 bp insertion) |
| Chromosome | V |
| Putative gene structure | complement(join(14506..14572, 14619..14719, 14823..15497, 15556..15813, 15862..16085, 16130..16234, 16282..16541, 16584..16660)) |
| Map position | 3.32 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | IntRev:CGCAGTAACCACTGTCGTCT,ExtRev:CGGGATTGAGCTATACTATG,ExtFwd:GTTTACAGAGCAGCGTGATG,IntFwd:TATAAAGCCTCAGCGGCGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Mauro MS, Celma G, Zimyanin V, Magaj MM, Gibson KH, Redemann S, Bahmanyar S.
Ndc1 drives nuclear pore complex assembly independent of membrane biogenesis to promote nuclear formation and growth.
Elife 2022 11
[ PubMed ID = 35852146 ]
[ RRC reference ]
|
Askjaer P, Galy V, Meister P.
Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans.
Methods Cell Biol 2014 122 277-310
[ PubMed ID = 24857735 ]
[ RRC reference ]
|
Gorjánácz M, Jaedicke A, Mattaj IW.
What can Caenorhabditis elegans tell us about the nuclear envelope?
FEBS Lett 2007 581(15) 2794-801
[ PubMed ID = 17418822 ]
[ RRC reference ]
|
Stavru F, Hülsmann BB, Spang A, Hartmann E, Cordes VC, Görlich D.
NDC1: a crucial membrane-integral nucleoporin of metazoan nuclear pore complexes.
J Cell Biol 2006 173(4) 509-19
[ PubMed ID = 16702233 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.