分離済み変異体

tm1842

Allele Nametm1842
BalanceNot Required
OutCrossNot Accepted
Sequence NameF45G2.3
Gene Nameexo-1
Worm BaseAllele Name tm1842
Gene Name exo-1
Sequence F45G2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Gartner: no radiation sensitivity. Dr. K. Nishiwaki: normal DTC migration. Dr. S. Boulton: not required for the S-phase checkpoint.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17446/17447-18005/18006 (559 bp deletion)
ChromosomeIII
Putative gene structurejoin(17200..17247, 17295..17504, 17561..18001, 18071..18358, 18412..18507, 18563..18636, 18687..18768, 18818..19305, 19367..19559)
Map position21.21
Balancer
Map position of balancer
Sequence of primersIntFwd:CGTCTCTATGCATTTACGCT,IntRev:GATTGAGAAGCGGCGATTGA,ExtFwd:GCCGACTGTGGCGTCTCTAT,ExtRev:TCTATCCGGCAACGACGGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rieckher M, Gallrein C, Alquezar-Artieda N, Bourached-Silva N, Vaddavalli PL, Mares D, Backhaus M, Blindauer T, Greger K, Wiesner E, Pontel LB, Schumacher B.
Distinct DNA repair mechanisms prevent formaldehyde toxicity during development, reproduction and aging.
Nucleic Acids Res 2024 52(14) 8271-8285 
[ PubMed ID = 38894680 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716 
[ PubMed ID = 36176234 ] [ RRC reference ]

Bae W, Park JH, Lee MH, Park HW, Koo HS.
Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans.
FEBS J 2020 287(6) 1101-1115 
[ PubMed ID = 31593615 ] [ RRC reference ]

Macaisne N, Kessler Z, Yanowitz JL.
Meiotic Double-Strand Break Proteins Influence Repair Pathway Utilization.
Genetics 2018 210(3) 843-856 
[ PubMed ID = 30242011 ] [ RRC reference ]

Girard C, Roelens B, Zawadzki KA, Villeneuve AM.
Interdependent and separable functions of Caenorhabditis elegans MRN-C complex members couple formation and repair of meiotic DSBs.
Proc Natl Acad Sci U S A 2018 115(19) E4443-E4452 
[ PubMed ID = 29686104 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Ryu JS, Koo HS.
The Caenorhabditis elegans WRN helicase promotes double-strand DNA break repair by mediating end resection and checkpoint activation.
FEBS Lett 2017 591(14) 2155-2166 
[ PubMed ID = 28640365 ] [ RRC reference ]

van Schendel R, Roerink SF, Portegijs V, van den Heuvel S, Tijsterman M.
Polymerase Θ is a key driver of genome evolution and of CRISPR/Cas9-mediated mutagenesis.
Nat Commun 2015 6 7394 
[ PubMed ID = 26077599 ] [ RRC reference ]

Yin Y, Smolikove S.
Impaired resection of meiotic double-strand breaks channels repair to nonhomologous end joining in Caenorhabditis elegans.
Mol Cell Biol 2013 33(14) 2732-47 
[ PubMed ID = 23671188 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet 2013 9(7) e1003582 
[ PubMed ID = 23874209 ] [ RRC reference ]

SenGupta T, Torgersen ML, Kassahun H, Vellai T, Simonsen A, Nilsen H.
Base excision repair AP endonucleases and mismatch repair act together to induce checkpoint-mediated autophagy.
Nat Commun 2013 4 2674 
[ PubMed ID = 24154628 ] [ RRC reference ]

Lemmens BB, Johnson NM, Tijsterman M.
COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining.
PLoS Genet 2013 9(2) e1003276 
[ PubMed ID = 23408909 ] [ RRC reference ]