分離済み変異体

tm1830

Allele Nametm1830
BalanceNot Required
OutCrossNot Accepted
Sequence NameK04F10.2
Gene NameK04F10.2
Worm BaseAllele Name tm1830
Gene Name K04F10.2
Sequence K04F10.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: normal dye filling and normal osmolarity sensing.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29915/29916-30262/30263 (347 bp deletion)
ChromosomeI
Putative gene structurejoin(28659..28756, 28800..28932, 29465..29632, 29689..30067, 30417..30564, 30617..30948, 31284..31394, 31442..31541, 31585..31726, 31780..31875)
Map position1
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGAGAGCAGTGAAGCCTGA,IntFwd:CCCGTATAGCTGTTACTTAC,ExtRev:CATCGGAAGTGGTCACTGTG,IntRev:GGCTATGTTCATCCACAAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sanders AA, de Vrieze E, Alazami AM, Alzahrani F, Malarkey EB, Sorusch N, Tebbe L, Kuhns S, van Dam TJ, Alhashem A, Tabarki B, Lu Q, Lambacher NJ, Kennedy JE, Bowie RV, Hetterschijt L, van Beersum S, van Reeuwijk J, Boldt K, Kremer H, Kesterson RA, Monies D, Abouelhoda M, Roepman R, Huynen MH, Ueffing M, Russell RB, Wolfrum U, Yoder BK, van Wijk E, Alkuraya FS, Blacque OE.
KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome.
Genome Biol 2015 16 293 
[ PubMed ID = 26714646 ] [ RRC reference ]