分離済み変異体

tm1826

Allele Name

tm1826

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F56D2.7

Gene Name

ced-6

Worm Base

Allele Name

tm1826

Gene Name

ced-6

Sequence

F56D2.7

Phenotype

homozygous viable. Dr. K. Matsumoto: localization of APL-1::GFP protein was not altered. Dr. M. Hengartner: defective in engulfment of apoptotic cells.

Mutation site

17698/17699-CGA-18202/18203 (504 bp deletion + 3 bp insertion)

Chromosome

III

Putative gene structure

join(17222..17375, 17720..17997, 18156..18446, 18496..18934, 18985..19301)

Map position

-1.53

Balancer

Map position of balancer

Sequence of primers

ExtRev:GGTGTTCCATAATCGCTTTC,IntFwd:AAGACCTTCAAACGATCGGT,ExtFwd:CGGACCCACCAAAAGAACCT,IntRev:GCTGCCCGAACTCAAATGAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Ko SH, Cho KA, Li X, Ran Q, Liu Z, Chen L.
GPX modulation promotes regenerative axonal fusion and functional recovery after injury through PSR-1 condensation.
Nat Commun 2025 16(1) 1079
[ PubMed ID = 39870634 ] [ RRC reference ]

Harders RH, Morthorst TH, Landgrebe LE, Lande AD, Fuglsang MS, Mortensen SB, Feteira-Montero V, Jensen HH, Wesseltoft JB, Olsen A.
CED-6/GULP and components of the clathrin-mediated endocytosis machinery act redundantly to correctly display CED-1 on the cell membrane in Caenorhabditis elegans.
G3 (Bethesda) 2024 14(7)
[ PubMed ID = 38696649 ] [ RRC reference ]

Harders RH, Morthorst TH, Lande AD, Hesselager MO, Mandrup OA, Bendixen E, Stensballe A, Olsen A.
Dynein links engulfment and execution of apoptosis via CED-4/Apaf1 in C. elegans.
Cell Death Dis 2018 9(10) 1012
[ PubMed ID = 30262881 ] [ RRC reference ]

Pinto SM, Almendinger J, Cabello J, Hengartner MO.
Loss of Acetylcholine Signaling Reduces Cell Clearance Deficiencies in Caenorhabditis elegans.
PLoS One 2016 11(2) e0149274
[ PubMed ID = 26872385 ] [ RRC reference ]

Neukomm LJ, Zeng S, Frei AP, Huegli PA, Hengartner MO.
Small GTPase CDC-42 promotes apoptotic cell corpse clearance in response to PAT-2 and CED-1 in C. elegans.
Cell Death Differ 2014 21(6) 845-53
[ PubMed ID = 24632947 ] [ RRC reference ]

Morthorst TH, Olsen A.
Cell-nonautonomous inhibition of radiation-induced apoptosis by dynein light chain 1 in Caenorhabditis elegans.
Cell Death Dis 2013 4(9) e799
[ PubMed ID = 24030151 ] [ RRC reference ]

Neukomm LJ, Nicot AS, Kinchen JM, Almendinger J, Pinto SM, Zeng S, Doukoumetzidis K, Tronchère H, Payrastre B, Laporte JF, Hengartner MO.
The phosphoinositide phosphatase MTM-1 regulates apoptotic cell corpse clearance through CED-5-CED-12 in C. elegans.
Development 2011 138(10) 2003-14
[ PubMed ID = 21490059 ] [ RRC reference ]

Neukomm LJ, Frei AP, Cabello J, Kinchen JM, Zaidel-Bar R, Ma Z, Haney LB, Hardin J, Ravichandran KS, Moreno S, Hengartner MO.
Loss of the RhoGAP SRGP-1 promotes the clearance of dead and injured cells in Caenorhabditis elegans.
Nat Cell Biol 2011 13(1) 79-86
[ PubMed ID = 21170032 ] [ RRC reference ]