分離済み変異体

tm1824

Allele Nametm1824
BalanceNot Required
OutCrossNot Accepted
Sequence NameC43H6.8
Gene Namehlh-15
Worm BaseAllele Name tm1824
Gene Name hlh-15
Sequence C43H6.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Ashrafi: healthy, fertile and has altered fat content at L4 and adult stage. Dr. O. Hobert: ASE & AIY fate markers normal. Dr. T. Ishihara: normal cehmotaxis to diacetyl, isoamylalcohol and benzaldehyde.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17822/17823-18685/18686 (863 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(17744..17888, 17939..18063))
Map position-15.57
Balancer
Map position of balancer
Sequence of primersExtRev:GTTAGGTACATGCGTAGCAT,IntFwd:GGGTGCACTGTATATGTCTG,ExtFwd:CCCATAGCAATTGGGTGCAC,IntRev:GCGTAGCATACCTGGCACAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Aguilar GR, Vidal B, Ji H, Evenblij J, Liao CP, Ji H, Valperga G, Fang-Yen C, Hobert O.
Functional analysis of conserved C. elegans bHLH family members uncovers lifespan control by a peptidergic hub neuron.
PLoS Biol 2025 23(1) e3002979 
[ PubMed ID = 39761329 ] [ RRC reference ]

Aguilar GR, Vidal B, Ji H, Evenblij J, Ji H, Valperga G, Liao CP, Fang-Yen C, Hobert O.
Functional analysis of conserved C. elegans bHLH family members uncovers lifespan control by a peptidergic hub neuron.
bioRxiv 2024   
[ PubMed ID = 39071424 ] [ RRC reference ]

Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M.
Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans.
Nat Commun 2024 15(1) 297 
[ PubMed ID = 38182628 ] [ RRC reference ]

Wang M, Witvliet D, Wu M, Kang L, Shao Z.
Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling.
PLoS Genet 2021 17(1) e1009295 
[ PubMed ID = 33428618 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]