分離済み変異体

tm1814

Allele Nametm1814
BalanceNot Required
OutCrossNot Accepted
Sequence NameR08C7.10
Gene Namewapl-1
Worm BaseAllele Name tm1814
Gene Name wapl-1
Sequence R08C7.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24298/24299-NG-24844/24845 (546 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(21564..21638, 21690..22022, 22355..22480, 22530..22604, 22659..22890, 22939..23015, 23065..23153, 23205..23674, 23720..23913, 23960..24114, 24164..24356, 24402..24582, 24638..24678))
Map position0.26
Balancer
Map position of balancer
Sequence of primersIntFwd:TCCTTGTCCCCCTAGACGGA,ExtRev:CCACTCACTTGCGTCGACGT,IntRev:CTCTCGGCGGCATTCTAAAC,ExtFwd:CTCTCACCAGCCGGATCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Castellano-Pozo M, Sioutas G, Barroso C, Prince JP, Lopez-Jimenez P, Davy J, Jaso-Tamame AL, Crawley O, Shao N, Page J, Martinez-Perez E.
The kleisin subunit controls the function of C. elegans meiotic cohesins by determining the mode of DNA binding and differential regulation by SCC-2 and WAPL-1.
Elife 2023 12  
[ PubMed ID = 37650378 ] [ RRC reference ]

Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM.
Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops.
PLoS Biol 2020 18(8) e3000817 
[ PubMed ID = 32813728 ] [ RRC reference ]

Hernandez MR, Davis MB, Jiang J, Brouhard EA, Severson AF, Csankovszki G.
Condensin I protects meiotic cohesin from WAPL-1 mediated removal.
PLoS Genet 2018 14(5) e1007382 
[ PubMed ID = 29768402 ] [ RRC reference ]

Crawley O, Barroso C, Testori S, Ferrandiz N, Silva N, Castellano-Pozo M, Jaso-Tamame AL, Martinez-Perez E.
Cohesin-interacting protein WAPL-1 regulates meiotic chromosome structure and cohesion by antagonizing specific cohesin complexes.
Elife 2016 5 e10851 
[ PubMed ID = 26841696 ] [ RRC reference ]