| Allele Name | tm1814 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | R08C7.10 |
| Gene Name | wapl-1 |
| Worm Base | Allele Name |
tm1814
|
| Gene Name |
wapl-1
|
| Sequence |
R08C7.10
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 24298/24299-NG-24844/24845 (546 bp deletion + 2 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(21564..21638, 21690..22022, 22355..22480, 22530..22604, 22659..22890, 22939..23015, 23065..23153, 23205..23674, 23720..23913, 23960..24114, 24164..24356, 24402..24582, 24638..24678)) |
| Map position | 0.26 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:TCCTTGTCCCCCTAGACGGA,ExtRev:CCACTCACTTGCGTCGACGT,IntRev:CTCTCGGCGGCATTCTAAAC,ExtFwd:CTCTCACCAGCCGGATCGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Castellano-Pozo M, Sioutas G, Barroso C, Prince JP, Lopez-Jimenez P, Davy J, Jaso-Tamame AL, Crawley O, Shao N, Page J, Martinez-Perez E. The kleisin subunit controls the function of C. elegans meiotic cohesins by determining the mode of DNA binding and differential regulation by SCC-2 and WAPL-1. Elife 2023 12
[ PubMed ID = 37650378 ]
[ RRC reference ]
|
Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM. Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops. PLoS Biol 2020 18(8) e3000817
[ PubMed ID = 32813728 ]
[ RRC reference ]
|
Hernandez MR, Davis MB, Jiang J, Brouhard EA, Severson AF, Csankovszki G. Condensin I protects meiotic cohesin from WAPL-1 mediated removal. PLoS Genet 2018 14(5) e1007382
[ PubMed ID = 29768402 ]
[ RRC reference ]
|
Crawley O, Barroso C, Testori S, Ferrandiz N, Silva N, Castellano-Pozo M, Jaso-Tamame AL, Martinez-Perez E. Cohesin-interacting protein WAPL-1 regulates meiotic chromosome structure and cohesion by antagonizing specific cohesin complexes. Elife 2016 5 e10851
[ PubMed ID = 26841696 ]
[ RRC reference ]
|
|