分離済み変異体

tm1813

Allele Name

tm1813

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T07G12.6

Gene Name

zim-1

Worm Base

Allele Name

tm1813

Gene Name

zim-1

Sequence

T07G12.6

Phenotype

homozygous viable. Dr. A. Dernburg: Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).

Mutation site

18979/18980-19460/19461 (481 bp deletion)

Chromosome

Putative gene structure

join(18656..18754, 18823..19547, 19722..20040)

Map position

4.62

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CAAGGAGATTGCTATGGCAG,IntRev:CGATGCCGACCGTTGATTTA,IntFwd:AGTGCAAGTGCAACATGCTG,ExtRev:CTGGTGACAACTATGGTGTC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Chou WY, Lin YC, Lee YH.
Short-term starvation stress at young adult stages enhances meiotic activity of germ cells to maintain spermatogenesis in aged male Caenorhabditis elegans.
Aging Cell 2019 18(3) e12930
[ PubMed ID = 30816005 ] [ RRC reference ]

Li Q, Saito TT, Martinez-Garcia M, Deshong AJ, Nadarajan S, Lawrence KS, Checchi PM, Colaiacovo MP, Engebrecht J.
The tumor suppressor BRCA1-BARD1 complex localizes to the synaptonemal complex and regulates recombination under meiotic dysfunction in Caenorhabditis elegans.
PLoS Genet 2018 14(11) e1007701
[ PubMed ID = 30383767 ] [ RRC reference ]

Davis-Roca AC, Muscat CC, Wignall SM.
Caenorhabditis elegans oocytes detect meiotic errors in the absence of canonical end-on kinetochore attachments.
J Cell Biol 2017 216(5) 1243-1253
[ PubMed ID = 28356326 ] [ RRC reference ]

Leopold LE, Heestand BN, Seong S, Shtessel L, Ahmed S.
Lack of pairing during meiosis triggers multigenerational transgene silencing in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2015 112(20) E2667-76
[ PubMed ID = 25941370 ] [ RRC reference ]

Kasper DM, Wang G, Gardner KE, Johnstone TG, Reinke V.
The C. elegans SNAPc component SNPC-4 coats piRNA domains and is globally required for piRNA abundance.
Dev Cell 2014 31(2) 145-58
[ PubMed ID = 25373775 ] [ RRC reference ]

Checchi PM, Engebrecht J.
Caenorhabditis elegans histone methyltransferase MET-2 shields the male X chromosome from checkpoint machinery and mediates meiotic sex chromosome inactivation.
PLoS Genet 2011 7(9) e1002267
[ PubMed ID = 21909284 ] [ RRC reference ]

Jaramillo-Lambert A, Harigaya Y, Vitt J, Villeneuve A, Engebrecht J.
Meiotic errors activate checkpoints that improve gamete quality without triggering apoptosis in male germ cells.
Curr Biol 2010 20(23) 2078-89
[ PubMed ID = 20970339 ] [ RRC reference ]

Bhalla N, Wynne DJ, Jantsch V, Dernburg AF.
ZHP-3 acts at crossovers to couple meiotic recombination with synaptonemal complex disassembly and bivalent formation in C. elegans.
PLoS Genet 2008 4(10) e1000235
[ PubMed ID = 18949042 ] [ RRC reference ]

Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6
[ PubMed ID = 17720937 ] [ RRC reference ]

Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev Cell 2006 11(6) 817-29
[ PubMed ID = 17141157 ] [ RRC reference ]