分離済み変異体

tm1811

Allele Nametm1811
BalanceNot Required
OutCrossNot Accepted
Sequence NameZC506.4
Gene Namemgl-1
Worm BaseAllele Name tm1811
Gene Name mgl-1
Sequence ZC506.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I Mori: normal thermotaxis. Dr. I. Katsura: normal avoidance behavior to 2-nonanone. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. J. Kaplan: wild type locomotion. Dr. L. Avery: Genes & Dev. 23, 12 (2009)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15030/15031-15889/15890 (859 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(11961..12120, 12523..12668, 12718..12965, 13008..13080, 13123..13381, 13671..13909, 13951..14052, 14110..14469, 14515..14611, 14983..15354, 15433..15547, 15663..15772, 15818..16006, 16129..16238, 16283..16364, 16422..16528, 17131..17166, 17254..17353, 17640..17734))
Map position1.73
Balancer
Map position of balancer
Sequence of primersExtFwd:CATCATCTGGACATATCGCT,IntFwd:AGCCCATGAGCAATGGCATA,ExtRev:AATGCACCGAGGCTGAATTA,IntRev:TCCGAATACCCGGAGATATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Xue W, Chen Y, Lei Z, Wang Y, Liu J, Wen X, Xu F, Chen P, Wu Z, Jin YN, Yu YV.
Calcium levels in ASER neurons determine behavioral valence by engaging distinct neuronal circuits in C. elegans.
Nat Commun 2025 16(1) 1814 
[ PubMed ID = 39979341 ] [ RRC reference ]

Cowen MH, Haskell D, Zoga K, Reddy KC, Chalasani SH, Hart MP.
Conserved autism-associated genes tune social feeding behavior in C. elegans.
Nat Commun 2024 15(1) 9301 
[ PubMed ID = 39468047 ] [ RRC reference ]

Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M.
Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans.
Nat Commun 2024 15(1) 297 
[ PubMed ID = 38182628 ] [ RRC reference ]

Ajayi T, Thomas A, Nikolic M, Henderson L, Zaheri A, Dwyer DS.
Evolutionary conservation of putative suicidality-related risk genes that produce diminished motivation corrected by clozapine, lithium and antidepressants.
Front Psychiatry 2024 15 1341735 
[ PubMed ID = 38362034 ] [ RRC reference ]

Cowen MH, Reddy KC, Chalasani SH, Hart MP.
Conserved autism-associated genes tune social feeding behavior in C. elegans.
bioRxiv 2023   
[ PubMed ID = 38106124 ] [ RRC reference ]

Peng JY, Liu X, Zeng XT, Hao Y, Zhang JH, Li Q, Tong XJ.
Early pheromone perception remodels neurodevelopment and accelerates neurodegeneration in adult C. elegans.
Cell Rep 2023 42(6) 112598 
[ PubMed ID = 37289584 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Motomura H, Ioroi M, Murakami K, Kuhara A, Ohta A.
Head-tail-head neural wiring underlies gut fat storage in Caenorhabditis elegans temperature acclimation.
Proc Natl Acad Sci U S A 2022 119(32) e2203121119 
[ PubMed ID = 35914124 ] [ RRC reference ]

Chai CM, Torkashvand M, Seyedolmohadesin M, Park H, Venkatachalam V, Sternberg PW.
Interneuron control of C. elegans developmental decision-making.
Curr Biol 2022 32(10) 2316-2324.e4 
[ PubMed ID = 35447086 ] [ RRC reference ]

Kang C, Avery L.
The FMRFamide Neuropeptide FLP-20 Acts as a Systemic Signal for Starvation Responses in Caenorhabditis elegans.
Mol Cells 2021 44(7) 529-537 
[ PubMed ID = 34140426 ] [ RRC reference ]

Wang M, Witvliet D, Wu M, Kang L, Shao Z.
Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling.
PLoS Genet 2021 17(1) e1009295 
[ PubMed ID = 33428618 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Katz M, Corson F, Keil W, Singhal A, Bae A, Lu Y, Liang Y, Shaham S.
Glutamate spillover in C. elegans triggers repetitive behavior through presynaptic activation of MGL-2/mGluR5.
Nat Commun 2019 10(1) 1882 
[ PubMed ID = 31015396 ] [ RRC reference ]

Dillon J, Holden-Dye L, O'Connor V.
Yeast two-hybrid screening identifies MPZ-1 and PTP-1 as candidate scaffolding proteins of metabotropic glutamate receptors in Caenorhabditis elegans.
Invert Neurosci 2018 18(4) 16 
[ PubMed ID = 30417267 ] [ RRC reference ]

Kuramochi M, Doi M.
An Excitatory/Inhibitory Switch From Asymmetric Sensory Neurons Defines Postsynaptic Tuning for a Rapid Response to NaCl in Caenorhabditis elegans.
Front Mol Neurosci 2018 11 484 
[ PubMed ID = 30687001 ] [ RRC reference ]

Jeong H, Paik YK.
MGL-1 on AIY neurons translates starvation to reproductive plasticity via neuropeptide signaling in Caenorhabditis elegans.
Dev Biol 2017 430(1) 80-89 
[ PubMed ID = 28807780 ] [ RRC reference ]

Park D, Hahm JH, Park S, Ha G, Chang GE, Jeong H, Kim H, Kim S, Cheong E, Paik YK.
A conserved neuronal DAF-16/FoxO plays an important role in conveying pheromone signals to elicit repulsion behavior in Caenorhabditis elegans.
Sci Rep 2017 7(1) 7260 
[ PubMed ID = 28775361 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr Biol 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J Neurosci 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]