分離済み変異体

tm1801

Allele Nametm1801
BalanceNot Required
OutCrossNot Accepted
Sequence NameT24H7.5
Gene Nametat-4
Worm BaseAllele Name tm1801
Gene Name tat-4
Sequence T24H7.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Tuck: no obvious defects in endocytosis. Dr. M. Han: fatty acid composition normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10217/10218-12150/12151 (1933 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(4483..4537, 4584..4876, 4926..5207, 5257..5557, 5743..5868, 5912..6156, 6210..6360, 6407..6700, 6748..6972, 8896..9338, 9394..9573, 10127..10223, 10266..10434, 10631..10733, 10781..11336, 11713..11831))
Map position-0.4
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGCTGAAGTGATAGCGCCA,IntFwd:GATAGCGCCATACAATACCA,ExtRev:GTACATGGGGCAATCCGTCA,IntRev:GCAATCCGTCACATGGGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nilsson L, Jonsson E, Tuck S.
Caenorhabditis elegans numb inhibits endocytic recycling by binding TAT-1 aminophospholipid translocase.
Traffic 2011 12(12) 1839-49 
[ PubMed ID = 21917090 ] [ RRC reference ]

Seamen E, Blanchette JM, Han M.
P-type ATPase TAT-2 negatively regulates monomethyl branched-chain fatty acid mediated function in post-embryonic growth and development in C. elegans.
PLoS Genet 2009 5(8) e1000589 
[ PubMed ID = 19662161 ] [ RRC reference ]

Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA.
An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases.
BMC Dev Biol 2008 8 96 
[ PubMed ID = 18831765 ] [ RRC reference ]