| Allele Name | tm1801 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T24H7.5 |
| Gene Name | tat-4 |
| Worm Base | Allele Name |
tm1801
|
| Gene Name |
tat-4
|
| Sequence |
T24H7.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S. Tuck: no obvious defects in endocytosis. Dr. M. Han: fatty acid composition normal. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10217/10218-12150/12151 (1933 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(4483..4537, 4584..4876, 4926..5207, 5257..5557, 5743..5868, 5912..6156, 6210..6360, 6407..6700, 6748..6972, 8896..9338, 9394..9573, 10127..10223, 10266..10434, 10631..10733, 10781..11336, 11713..11831)) |
| Map position | -0.4 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CTGCTGAAGTGATAGCGCCA,IntFwd:GATAGCGCCATACAATACCA,ExtRev:GTACATGGGGCAATCCGTCA,IntRev:GCAATCCGTCACATGGGACA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Nilsson L, Jonsson E, Tuck S. Caenorhabditis elegans numb inhibits endocytic recycling by binding TAT-1 aminophospholipid translocase. Traffic 2011 12(12) 1839-49
[ PubMed ID = 21917090 ]
[ RRC reference ]
|
Seamen E, Blanchette JM, Han M. P-type ATPase TAT-2 negatively regulates monomethyl branched-chain fatty acid mediated function in post-embryonic growth and development in C. elegans. PLoS Genet 2009 5(8) e1000589
[ PubMed ID = 19662161 ]
[ RRC reference ]
|
Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA. An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases. BMC Dev Biol 2008 8 96
[ PubMed ID = 18831765 ]
[ RRC reference ]
|
|