Home > 分離済み変異体 > tm1800

分離済み変異体

Allele Name		tm1800
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F33D4.1a
Gene Name		nhr-8
Worm Base	Allele Name	tm1800 (x1)
	Gene Name	nhr-8
	Sequence	F33D4.1a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		36915/36916-37358/37359 (443 bp deletion)
Chromosome		IV
Putative gene structure		join(36222..36302, 36851..36943, 36992..37284, 37610..37706, 37753..37960, 38164..38364, 38411..38881, 38929..38998, 39074..39242)
Map position		3.42
Balancer		nT1
Map position of balancer
Sequence of primers		ExtFwd:TGGACGAGTCTCGAAGGTCT,IntFwd:GCCTCTTGACGCTGGTTTAA,ExtRev:ACACTGCTTGAATTGGAGTC,IntRev:GCGCAGCCATTTGGGCCATA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Yu J, Gao X, Shi H, Zhang L, Nie W, Zhang R, Fang M, Liu Y, Yan Y, Fan B, Wu C, Huang C, Fan S. Activation of Nuclear Receptor CAR: A Pathway to Delay Aging through Enhanced Capacity for Xenobiotic Resistance. Adv Sci (Weinh) 2025 12(12) e2416823  [ PubMed ID = 39887667 ] [ RRC reference ] Gao X, Yu J, Li Y, Shi H, Zhang L, Fang M, Liu Y, Huang C, Fan S. 27-Hydroxymangiferolic Acid Extends Lifespan and Improves Neurodegeneration in Caenorhabditis elegans by Activating Nuclear Receptors. Molecules 2025 30(5)   [ PubMed ID = 40076235 ] [ RRC reference ] Fan S, Yan Y, Xia Y, Zhou Z, Luo L, Zhu M, Han Y, Yao D, Zhang L, Fang M, Peng L, Yu J, Liu Y, Gao X, Guan H, Li H, Wang C, Wu X, Zhu H, Cao Y, Huang C. Pregnane X receptor agonist nomilin extends lifespan and healthspan in preclinical models through detoxification functions. Nat Commun 2023 14(1) 3368  [ PubMed ID = 37291126 ] [ RRC reference ] Oh M, Yeom J, Schraermeyer U, Julien-Schraermeyer S, Lim YH. Remofuscin induces xenobiotic detoxification via a lysosome-to-nucleus signaling pathway to extend the Caenorhabditis elegans lifespan. Sci Rep 2022 12(1) 7161  [ PubMed ID = 35504961 ] [ RRC reference ] Otarigho B, Aballay A. Cholesterol Regulates Innate Immunity via Nuclear Hormone Receptor NHR-8. iScience 2020 23(5) 101068  [ PubMed ID = 32361270 ] [ RRC reference ] Ménez C, Alberich M, Courtot E, Guegnard F, Blanchard A, Aguilaniu H, Lespine A. The transcription factor NHR-8: A new target to increase ivermectin efficacy in nematodes. PLoS Pathog 2019 15(2) e1007598  [ PubMed ID = 30759156 ] [ RRC reference ] Ludewig AH, Gimond C, Judkins JC, Thornton S, Pulido DC, Micikas RJ, Döring F, Antebi A, Braendle C, Schroeder FC. Larval crowding accelerates C. elegans development and reduces lifespan. PLoS Genet 2017 13(4) e1006717  [ PubMed ID = 28394895 ] [ RRC reference ] Magner DB, Wollam J, Shen Y, Hoppe C, Li D, Latza C, Rottiers V, Hutter H, Antebi A. The NHR-8 nuclear receptor regulates cholesterol and bile acid homeostasis in C. elegans. Cell Metab 2013 18(2) 212-24  [ PubMed ID = 23931753 ] [ RRC reference ]