| Allele Name | tm1799 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F53B3.6 |
| Gene Name | F53B3.6 |
| Worm Base | Allele Name |
tm1799
|
| Gene Name |
F53B3.6
|
| Sequence |
F53B3.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 16091/16092-16650/16651 (559 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(16562..16809, 16866..17583) |
| Map position | -12.69 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CACCTACTATGGCGCTACTC,IntRev:ATACCTGTGGCTGTTGAGTG,ExtRev:TCGTAGCTCCATGGTGGCCA,IntFwd:TGGAGGGAACGAAACTCATG |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Oh KH, Sheoran S, Richmond JE, Kim H. Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans. FASEB J 2020 34(6) 8204-8216
[ PubMed ID = 32294300 ]
[ RRC reference ]
|
Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM. Mutations in Fis1 disrupt orderly disposal of defective mitochondria. Mol Biol Cell 2014 25(1) 145-59
[ PubMed ID = 24196833 ]
[ RRC reference ]
|
|