分離済み変異体

tm1782

Allele Nametm1782
BalanceNot Required
OutCrossNot Accepted
Sequence NameC16D6.2
Gene Namenpr-4
Worm BaseAllele Name tm1782
Gene Name npr-4
Sequence C16D6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. W. Schafer: fertile, locomotion grossly normal. Dr. P. Bazzicalupo: fertility reduced. Dr. R.H. Horvitz: wild-type for gross morphology, locomotion and growth rate, does not suppress locomotion defects by flp-18 overexpression.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26740/26741-27966/27967 (1226 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(26247..26453, 26546..26663, 26719..27077, 27129..27248, 27297..27450, 27500..27597, 27649..27717))
Map position7.18
Balancer
Map position of balancer
Sequence of primersExtFwd:GGGTGAAGAGAGTTGTGTAC,IntFwd:AAGGATTTCATCGCGTGGTC,ExtRev:ACGTTCTGTACTTCGCTGGT,IntRev:GTACTTCGCTGGTAGGAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rossi L, Amoako K, Busack I, Golinelli L, Courtney A, Besseling J, Schafer W, Beets I, Bringmann H.
The neuropeptide FLP-11 induces and self-inhibits sleep through the receptor DMSR-1 in Caenorhabiditis elegans.
Curr Biol 2025 35(9) 2183-2194.e10 
[ PubMed ID = 40273913 ] [ RRC reference ]

Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215 
[ PubMed ID = 40224011 ] [ RRC reference ]

Xue W, Chen Y, Lei Z, Wang Y, Liu J, Wen X, Xu F, Chen P, Wu Z, Jin YN, Yu YV.
Calcium levels in ASER neurons determine behavioral valence by engaging distinct neuronal circuits in C. elegans.
Nat Commun 2025 16(1) 1814 
[ PubMed ID = 39979341 ] [ RRC reference ]

Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12  
[ PubMed ID = 38446031 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Chai CM, Park H, Sternberg PW.
Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision.
Curr Biol 2022 32(15) 3365-3373.e6 
[ PubMed ID = 35679871 ] [ RRC reference ]

Reilly DK, McGlame EJ, Vandewyer E, Robidoux AN, Muirhead CS, Northcott HT, Joyce W, Alkema MJ, Gegear RJ, Beets I, Srinivasan J.
Distinct neuropeptide-receptor modules regulate a sex-specific behavioral response to a pheromone.
Commun Biol 2021 4(1) 1018 
[ PubMed ID = 34465863 ] [ RRC reference ]

Bhardwaj A, Pandey P, Babu K.
Control of Locomotory Behavior of Caenorhabditis elegans by the Immunoglobulin Superfamily Protein RIG-3.
Genetics 2020 214(1) 135-145 
[ PubMed ID = 31740450 ] [ RRC reference ]

Tao L, Porto D, Li Z, Fechner S, Lee SA, Goodman MB, Xu XZS, Lu H, Shen K.
Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans.
Dev Cell 2019 51(5) 617-631.e3 
[ PubMed ID = 31735664 ] [ RRC reference ]

Park J, Choi W, Dar AR, Butcher RA, Kim K.
Neuropeptide Signaling Regulates Pheromone-Mediated Gene Expression of a Chemoreceptor Gene in C. elegans.
Mol Cells 2019 42(1) 28-35 
[ PubMed ID = 30453729 ] [ RRC reference ]

Bhardwaj A, Thapliyal S, Dahiya Y, Babu K.
FLP-18 Functions through the G-Protein-Coupled Receptors NPR-1 and NPR-4 to Modulate Reversal Length in Caenorhabditis elegans.
J Neurosci 2018 38(20) 4641-4654 
[ PubMed ID = 29712787 ] [ RRC reference ]

Lim MA, Chitturi J, Laskova V, Meng J, Findeis D, Wiekenberg A, Mulcahy B, Luo L, Li Y, Lu Y, Hung W, Qu Y, Ho CY, Holmyard D, Ji N, McWhirter R, Samuel AD, Miller DM, Schnabel R, Calarco JA, Zhen M.
Neuroendocrine modulation sustains the C. elegans forward motor state.
Elife 2016 5  
[ PubMed ID = 27855782 ] [ RRC reference ]

Turek M, Besseling J, Spies JP, König S, Bringmann H.
Sleep-active neuron specification and sleep induction require FLP-11 neuropeptides to systemically induce sleep.
Elife 2016 5  
[ PubMed ID = 26949257 ] [ RRC reference ]

Yu Y, Zhi L, Guan X, Wang D, Wang D.
FLP-4 neuropeptide and its receptor in a neuronal circuit regulate preference choice through functions of ASH-2 trithorax complex in Caenorhabditis elegans.
Sci Rep 2016 6 21485 
[ PubMed ID = 26887501 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]

Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L.
Neuropeptide GPCRs in C. elegans.
Front Endocrinol (Lausanne) 2012 3 167 
[ PubMed ID = 23267347 ] [ RRC reference ]

Milward K, Busch KE, Murphy RJ, de Bono M, Olofsson B.
Neuronal and molecular substrates for optimal foraging in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(51) 20672-7 
[ PubMed ID = 22135454 ] [ RRC reference ]

Cohen M, Reale V, Olofsson B, Knights A, Evans P, de Bono M.
Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling.
Cell Metab 2009 9(4) 375-85 
[ PubMed ID = 19356718 ] [ RRC reference ]