分離済み変異体

tm1779

Allele Nametm1779
BalanceNot Required
OutCrossNot Accepted
Sequence NameEEED8.9
Gene Namepink-1
Worm BaseAllele Name tm1779
Gene Name pink-1
Sequence EEED8.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Gartner: no phenotype associating oxidative stress response. Dr. E. Schmidt: J. Biol. Chem. in press.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12197/12198-12547/12548 (350 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(9911..10805, 10853..11251, 11299..11528, 11577..11734, 11779..12016, 12068..12199, 12250..12312))
Map position-1.78
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTAGGTTGGCCATGATAGT,IntFwd:TCATTAGGATCTCGCTTGAG,ExtRev:CGCTGAAGGCTCGGATGATG,IntRev:AGCCTCGGGCTTATTAAGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ganguly U, Carroll T, Nehrke K, Johnson GVW.
Mitochondrial Quality Control in Alzheimer's Disease: Insights from Caenorhabditis elegans Models.
Antioxidants (Basel) 2024 13(11)  
[ PubMed ID = 39594485 ] [ RRC reference ]

Earnshaw R, Zhang YT, Heymann G, Fujisawa K, Hui S, Kapadia M, Kalia LV, Kalia SK.
Disease-associated mutations in C-terminus of HSP70 interacting protein (CHIP) impair its ability to negatively regulate mitophagy.
Neurobiol Dis 2024 200 106625 
[ PubMed ID = 39117117 ] [ RRC reference ]

Tataridas-Pallas N, Aman Y, Williams R, Chapman H, Cheng KJH, Gomez-Paredes C, Bates GP, Labbadia J.
Mitochondrial clearance and increased HSF-1 activity are coupled to promote longevity in fasted Caenorhabditis elegans.
iScience 2024 27(6) 109834 
[ PubMed ID = 38784016 ] [ RRC reference ]

Sharifi S, Chaudhari P, Martirosyan A, Eberhardt AO, Witt F, Gollowitzer A, Lange L, Woitzat Y, Okoli EM, Li H, Rahnis N, Kirkpatrick J, Werz O, Ori A, Koeberle A, Bierhoff H, Ermolaeva M.
Reducing the metabolic burden of rRNA synthesis promotes healthy longevity in Caenorhabditis elegans.
Nat Commun 2024 15(1) 1702 
[ PubMed ID = 38402241 ] [ RRC reference ]

Moreno A, Taffet A, Tjahjono E, Anderson QL, Kirienko NV.
Examining Sporadic Cancer Mutations Uncovers a Set of Genes Involved in Mitochondrial Maintenance.
Genes (Basel) 2023 14(5)  
[ PubMed ID = 37239369 ] [ RRC reference ]

Campos JC, Marchesi Bozi LH, Krum B, Grassmann Bechara LR, Ferreira ND, Arini GS, Albuquerque RP, Traa A, Ogawa T, van der Bliek AM, Beheshti A, Chouchani ET, Van Raamsdonk JM, Blackwell TK, Ferreira JCB.
Exercise preserves physical fitness during aging through AMPK and mitochondrial dynamics.
Proc Natl Acad Sci U S A 2023 120(2) e2204750120 
[ PubMed ID = 36595699 ] [ RRC reference ]

Cota V, Sohrabi S, Kaletsky R, Murphy CT.
Oocyte mitophagy is critical for extended reproductive longevity.
PLoS Genet 2022 18(9) e1010400 
[ PubMed ID = 36126046 ] [ RRC reference ]

Vozdek R, Pramstaller PP, Hicks AA.
Functional Screening of Parkinson's Disease Susceptibility Genes to Identify Novel Modulators of α-Synuclein Neurotoxicity in Caenorhabditis elegans.
Front Aging Neurosci 2022 14 806000 
[ PubMed ID = 35572147 ] [ RRC reference ]

Tjahjono E, Pei J, Revtovich AV, Liu TE, Swadi A, Hancu MC, Tolar JG, Kirienko NV.
Mitochondria-affecting small molecules ameliorate proteostasis defects associated with neurodegenerative diseases.
Sci Rep 2021 11(1) 17733 
[ PubMed ID = 34489512 ] [ RRC reference ]

Cho I, Song HO, Cho JH.
Flavonoids mitigate neurodegeneration in aged Caenorhabditis elegans by mitochondrial uncoupling.
Food Sci Nutr 2020 8(12) 6633-6642 
[ PubMed ID = 33312547 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74 
[ PubMed ID = 32600387 ] [ RRC reference ]

Rolland SG, Schneid S, Schwarz M, Rackles E, Fischer C, Haeussler S, Regmi SG, Yeroslaviz A, Habermann B, Mokranjac D, Lambie E, Conradt B.
Compromised Mitochondrial Protein Import Acts as a Signal for UPRmt.
Cell Rep 2019 28(7) 1659-1669.e5 
[ PubMed ID = 31412237 ] [ RRC reference ]

Hartman JH, Gonzalez-Hunt C, Hall SM, Ryde IT, Caldwell KA, Caldwell GA, Meyer JN.
Genetic Defects in Mitochondrial Dynamics in Caenorhabditis elegans Impact Ultraviolet C Radiation- and 6-hydroxydopamine-Induced Neurodegeneration.
Int J Mol Sci 2019 20(13)  
[ PubMed ID = 31261893 ] [ RRC reference ]

Fang EF, Hou Y, Palikaras K, Adriaanse BA, Kerr JS, Yang B, Lautrup S, Hasan-Olive MM, Caponio D, Dan X, Rocktäschel P, Croteau DL, Akbari M, Greig NH, Fladby T, Nilsen H, Cader MZ, Mattson MP, Tavernarakis N, Bohr VA.
Mitophagy inhibits amyloid-β and tau pathology and reverses cognitive deficits in models of Alzheimer's disease.
Nat Neurosci 2019 22(3) 401-412 
[ PubMed ID = 30742114 ] [ RRC reference ]

Kang D, Kirienko DR, Webster P, Fisher AL, Kirienko NV.
Pyoverdine, a siderophore from Pseudomonas aeruginosa, translocates into C. elegans, removes iron, and activates a distinct host response.
Virulence 2018 9(1) 804-817 
[ PubMed ID = 29532717 ] [ RRC reference ]

Hibshman JD, Leuthner TC, Shoben C, Mello DF, Sherwood DR, Meyer JN, Baugh LR.
Nonselective autophagy reduces mitochondrial content during starvation in Caenorhabditis elegans.
Am J Physiol Cell Physiol 2018 315(6) C781-C792 
[ PubMed ID = 30133321 ] [ RRC reference ]

Kim H, Perentis RJ, Caldwell GA, Caldwell KA.
Gene-by-environment interactions that disrupt mitochondrial homeostasis cause neurodegeneration in C. elegans Parkinson's models.
Cell Death Dis 2018 9(5) 555 
[ PubMed ID = 29748634 ] [ RRC reference ]

Ahier A, Dai CY, Tweedie A, Bezawork-Geleta A, Kirmes I, Zuryn S.
Affinity purification of cell-specific mitochondria from whole animals resolves patterns of genetic mosaicism.
Nat Cell Biol 2018 20(3) 352-360 
[ PubMed ID = 29358705 ] [ RRC reference ]

Cho I, Song HO, Cho JH.
Mitochondrial Uncoupling Attenuates Age-Dependent Neurodegeneration in C. elegans.
Mol Cells 2017 40(11) 864-870 
[ PubMed ID = 29081084 ] [ RRC reference ]

Martinez BA, Petersen DA, Gaeta AL, Stanley SP, Caldwell GA, Caldwell KA.
Dysregulation of the Mitochondrial Unfolded Protein Response Induces Non-Apoptotic Dopaminergic Neurodegeneration in C. elegans Models of Parkinson's Disease.
J Neurosci 2017 37(46) 11085-11100 
[ PubMed ID = 29030433 ] [ RRC reference ]