| Allele Name | tm1773 |
| Allele Type | 通常株 |
| Sequence Name | H06H21.10 |
| Gene Name | tat-2 |
| Worm Base | Allele Name |
tm1773
|
| Gene Name |
tat-2
|
| Sequence |
H06H21.10
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. M. Han; fertile, normal growth. Dr. S. Tuck: no genetic interaction with tat-1 mutants. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 32173/32174-32800/32801 (627 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(21043..21078, 21494..21611, 21718..21815, 22337..22553, 22773..23101, 23909..24041, 24436..24829, 25605..25755, 25883..26031, 26077..26164, 27254..27397, 27604..27801, 27858..27983, 28790..29212, 30214..30282, 30419..30699, 31853..32108, 33083..33217, 33362..33460, 33510..33623, 33984..34094)) |
| Map position | 1.36 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GGACTAGGAACCACATCGTC,IntRev:AGTCGTCAACGAAATCCGCA,ExtRev:GGCTGAATCAAGTACAGCAA,IntFwd:CACATCGTCCCACGGTAGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Nilsson L, Jonsson E, Tuck S.
Caenorhabditis elegans numb inhibits endocytic recycling by binding TAT-1 aminophospholipid translocase.
Traffic 2011 12(12) 1839-49
[ PubMed ID = 21917090 ]
[ RRC reference ]
|
Seamen E, Blanchette JM, Han M.
P-type ATPase TAT-2 negatively regulates monomethyl branched-chain fatty acid mediated function in post-embryonic growth and development in C. elegans.
PLoS Genet 2009 5(8) e1000589
[ PubMed ID = 19662161 ]
[ RRC reference ]
|
Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA.
An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases.
BMC Dev Biol 2008 8 96
[ PubMed ID = 18831765 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.