分離済み変異体

tm1770

Allele Name

tm1770

Allele Type

通常株

Sequence Name

K11G9.6

Gene Name

mtl-1

Worm Base

Allele Name

tm1770

Gene Name

mtl-1

Sequence

K11G9.6

Phenotype

homozygous viable. Dr. C. Kenyon: no delay of developmental timing, normal in dauer test. Dr. I. Mori: normal thermotaxis when cultured at 23 C. Dr. M. Herman: life span change by some bacteria.

Mutation site

21423/21424-22002/22003 (579 bp deletion)

Chromosome

Putative gene structure

complement(join(21470..21681, 21802..21817))

Map position

0.13

Balancer

Map position of balancer

Sequence of primers

ExtRev:TAGATGTTTCAGACGTCACC,IntRev:CCTGTGGAGAAACGTGTAAG,ExtFwd:TGACCAGTGTCGTGAGCGAC,IntFwd:CAGGGTTTCATAGTCGGGGT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K.
Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor.
Proc Natl Acad Sci U S A 2021 118(42)
[ PubMed ID = 34649987 ] [ RRC reference ]

Okahata M, Wei AD, Ohta A, Kuhara A.
Cold acclimation via the KQT-2 potassium channel is modulated by oxygen in Caenorhabditis elegans.
Sci Adv 2019 5(2) eaav3631
[ PubMed ID = 30775442 ] [ RRC reference ]

Dalton HM, Curran SP.
Hypodermal responses to protein synthesis inhibition induce systemic developmental arrest and AMPK-dependent survival in Caenorhabditis elegans.
PLoS Genet 2018 14(7) e1007520
[ PubMed ID = 30020921 ] [ RRC reference ]

Zhi L, Yu Y, Li X, Wang D, Wang D.
Molecular Control of Innate Immune Response to Pseudomonas aeruginosa Infection by Intestinal let-7 in Caenorhabditis elegans.
PLoS Pathog 2017 13(1) e1006152
[ PubMed ID = 28095464 ] [ RRC reference ]

Smolentseva O, Gusarov I, Gautier L, Shamovsky I, DeFrancesco AS, Losick R, Nudler E.
Mechanism of biofilm-mediated stress resistance and lifespan extension in C. elegans.
Sci Rep 2017 7(1) 7137
[ PubMed ID = 28769037 ] [ RRC reference ]

Zhao L, Rui Q, Wang D.
Molecular basis for oxidative stress induced by simulated microgravity in nematode Caenorhabditis elegans.
Sci Total Environ 2017 607-608 1381-1390
[ PubMed ID = 28738528 ] [ RRC reference ]

Hall JA, McElwee MK, Freedman JH.
Identification of ATF-7 and the insulin signaling pathway in the regulation of metallothionein in C. elegans suggests roles in aging and reactive oxygen species.
PLoS One 2017 12(6) e0177432
[ PubMed ID = 28632756 ] [ RRC reference ]

Ye B, Rui Q, Wu Q, Wang D.
Metallothioneins are required for formation of cross-adaptation response to neurobehavioral toxicity from lead and mercury exposure in nematodes.
PLoS One 2010 5(11) e14052
[ PubMed ID = 21124968 ] [ RRC reference ]

Helmcke KJ, Aschner M.
Hormetic effect of methylmercury on Caenorhabditis elegans.
Toxicol Appl Pharmacol 2010 248(2) 156-64
[ PubMed ID = 20691719 ] [ RRC reference ]

Sugi T, Nishida Y, Mori I.
Regulation of behavioral plasticity by systemic temperature signaling in Caenorhabditis elegans.
Nat Neurosci 2011 14(8) 984-92
[ PubMed ID = 21706021 ] [ RRC reference ]

Hall J, Haas KL, Freedman JH.
Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans.
Toxicol Sci 2012 128(2) 418-26
[ PubMed ID = 22552775 ] [ RRC reference ]

Polak N, Read DS, Jurkschat K, Matzke M, Kelly FJ, Spurgeon DJ, Stürzenbaum SR.
Metalloproteins and phytochelatin synthase may confer protection against zinc oxide nanoparticle induced toxicity in Caenorhabditis elegans.
Comp Biochem Physiol C Toxicol Pharmacol 2014 160 75-85
[ PubMed ID = 24333255 ] [ RRC reference ]

Höckner M, Dallinger R, Stürzenbaum SR.
Nematode and snail metallothioneins.
J Biol Inorg Chem 2011 16(7) 1057-65
[ PubMed ID = 21822727 ] [ RRC reference ]

Wu Q, Zhao Y, Li Y, Wang D.
Molecular signals regulating translocation and toxicity of graphene oxide in the nematode Caenorhabditis elegans.
Nanoscale 2014 6(19) 11204-12
[ PubMed ID = 25124895 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412
[ PubMed ID = 25048458 ] [ RRC reference ]

Zeitoun-Ghandour S, Charnock JM, Hodson ME, Leszczyszyn OI, Blindauer CA, Stürzenbaum SR.
The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium.
FEBS J 2010 277(11) 2531-42
[ PubMed ID = 20553489 ] [ RRC reference ]

Hughes SL, Bundy JG, Want EJ, Kille P, Stürzenbaum SR.
The metabolomic responses of Caenorhabditis elegans to cadmium are largely independent of metallothionein status, but dominated by changes in cystathionine and phytochelatins.
J Proteome Res 2009 8(7) 3512-9
[ PubMed ID = 19466807 ] [ RRC reference ]

Jiang GC, Hughes S, Stürzenbaum SR, Evje L, Syversen T, Aschner M.
Caenorhabditis elegans metallothioneins protect against toxicity induced by depleted uranium.
Toxicol Sci 2009 111(2) 345-54
[ PubMed ID = 19617453 ] [ RRC reference ]

Hughes S, Stürzenbaum SR.
Single and double metallothionein knockout in the nematode C. elegans reveals cadmium dependent and independent toxic effects on life history traits.
Environ Pollut 2007 145(2) 395-400
[ PubMed ID = 17141712 ] [ RRC reference ]

Cui Y, McBride SJ, Boyd WA, Alper S, Freedman JH.
Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity.
Genome Biol 2007 8(6) R122
[ PubMed ID = 17592649 ] [ RRC reference ]