分離済み変異体

tm1770

Allele Nametm1770
BalanceNot Required
OutCrossNot Accepted
Sequence NameK11G9.6
Gene Namemtl-1
Worm BaseAllele Name tm1770
Gene Name mtl-1
Sequence K11G9.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Kenyon: no delay of developmental timing, normal in dauer test. Dr. I. Mori: normal thermotaxis when cultured at 23 C. Dr. M. Herman: life span change by some bacteria.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21423/21424-22002/22003 (579 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(21470..21681, 21802..21817))
Map position0.13
Balancer
Map position of balancer
Sequence of primersExtRev:TAGATGTTTCAGACGTCACC,IntRev:CCTGTGGAGAAACGTGTAAG,ExtFwd:TGACCAGTGTCGTGAGCGAC,IntFwd:CAGGGTTTCATAGTCGGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Andric A, Niederwanger M, Albertini E, Jansen-Dürr P, Stürzenbaum SR, Dallinger R, Pedrini-Martha V, Weiss AKH.
A multi-domain snail metallothionein increases cadmium resistance and fitness in Caenorhabditis elegans.
Sci Rep 2024 14(1) 25589 
[ PubMed ID = 39462019 ] [ RRC reference ]

Essig YJ, Leszczyszyn OI, Almutairi N, Harrison-Smith A, Blease A, Zeitoun-Ghandour S, Webb SM, Blindauer CA, Stürzenbaum SR.
Juggling cadmium detoxification and zinc homeostasis: A division of labour between the two C. elegans metallothioneins.
Chemosphere 2024 350 141021 
[ PubMed ID = 38151062 ] [ RRC reference ]

Weishaupt AK, Lamann K, Tallarek E, Pezacki AT, Matier CD, Schwerdtle T, Aschner M, Chang CJ, Stürzenbaum SR, Bornhorst J.
Dysfunction in atox-1 and ceruloplasmin alters labile Cu levels and consequently Cu homeostasis in C. elegans.
Front Mol Biosci 2024 11 1354627 
[ PubMed ID = 38389896 ] [ RRC reference ]

Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K.
Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor.
Proc Natl Acad Sci U S A 2021 118(42)  
[ PubMed ID = 34649987 ] [ RRC reference ]

Okahata M, Wei AD, Ohta A, Kuhara A.
Cold acclimation via the KQT-2 potassium channel is modulated by oxygen in Caenorhabditis elegans.
Sci Adv 2019 5(2) eaav3631 
[ PubMed ID = 30775442 ] [ RRC reference ]

Dalton HM, Curran SP.
Hypodermal responses to protein synthesis inhibition induce systemic developmental arrest and AMPK-dependent survival in Caenorhabditis elegans.
PLoS Genet 2018 14(7) e1007520 
[ PubMed ID = 30020921 ] [ RRC reference ]

Zhao L, Rui Q, Wang D.
Molecular basis for oxidative stress induced by simulated microgravity in nematode Caenorhabditis elegans.
Sci Total Environ 2017 607-608 1381-1390 
[ PubMed ID = 28738528 ] [ RRC reference ]

Smolentseva O, Gusarov I, Gautier L, Shamovsky I, DeFrancesco AS, Losick R, Nudler E.
Mechanism of biofilm-mediated stress resistance and lifespan extension in C. elegans.
Sci Rep 2017 7(1) 7137 
[ PubMed ID = 28769037 ] [ RRC reference ]

Hall JA, McElwee MK, Freedman JH.
Identification of ATF-7 and the insulin signaling pathway in the regulation of metallothionein in C. elegans suggests roles in aging and reactive oxygen species.
PLoS One 2017 12(6) e0177432 
[ PubMed ID = 28632756 ] [ RRC reference ]

Zhi L, Yu Y, Li X, Wang D, Wang D.
Molecular Control of Innate Immune Response to Pseudomonas aeruginosa Infection by Intestinal let-7 in Caenorhabditis elegans.
PLoS Pathog 2017 13(1) e1006152 
[ PubMed ID = 28095464 ] [ RRC reference ]

Wu Q, Zhao Y, Li Y, Wang D.
Molecular signals regulating translocation and toxicity of graphene oxide in the nematode Caenorhabditis elegans.
Nanoscale 2014 6(19) 11204-12 
[ PubMed ID = 25124895 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]

Polak N, Read DS, Jurkschat K, Matzke M, Kelly FJ, Spurgeon DJ, Stürzenbaum SR.
Metalloproteins and phytochelatin synthase may confer protection against zinc oxide nanoparticle induced toxicity in Caenorhabditis elegans.
Comp Biochem Physiol C Toxicol Pharmacol 2014 160 75-85 
[ PubMed ID = 24333255 ] [ RRC reference ]

Hall J, Haas KL, Freedman JH.
Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans.
Toxicol Sci 2012 128(2) 418-26 
[ PubMed ID = 22552775 ] [ RRC reference ]

Höckner M, Dallinger R, Stürzenbaum SR.
Nematode and snail metallothioneins.
J Biol Inorg Chem 2011 16(7) 1057-65 
[ PubMed ID = 21822727 ] [ RRC reference ]

Sugi T, Nishida Y, Mori I.
Regulation of behavioral plasticity by systemic temperature signaling in Caenorhabditis elegans.
Nat Neurosci 2011 14(8) 984-92 
[ PubMed ID = 21706021 ] [ RRC reference ]

Ye B, Rui Q, Wu Q, Wang D.
Metallothioneins are required for formation of cross-adaptation response to neurobehavioral toxicity from lead and mercury exposure in nematodes.
PLoS One 2010 5(11) e14052 
[ PubMed ID = 21124968 ] [ RRC reference ]

Helmcke KJ, Aschner M.
Hormetic effect of methylmercury on Caenorhabditis elegans.
Toxicol Appl Pharmacol 2010 248(2) 156-64 
[ PubMed ID = 20691719 ] [ RRC reference ]

Zeitoun-Ghandour S, Charnock JM, Hodson ME, Leszczyszyn OI, Blindauer CA, Stürzenbaum SR.
The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium.
FEBS J 2010 277(11) 2531-42 
[ PubMed ID = 20553489 ] [ RRC reference ]

Jiang GC, Hughes S, Stürzenbaum SR, Evje L, Syversen T, Aschner M.
Caenorhabditis elegans metallothioneins protect against toxicity induced by depleted uranium.
Toxicol Sci 2009 111(2) 345-54 
[ PubMed ID = 19617453 ] [ RRC reference ]