分離済み変異体

tm1768

Allele Nametm1768
BalanceNot Required
OutCrossNot Accepted
Sequence NameM05B5.5a
Gene Namehlh-2
Worm BaseAllele Name tm1768
Gene Name hlh-2
Sequence M05B5.5a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. B. Conradt: 3% NSM sister cell survival at 20?C, sterile at 25?C. Dr. J. Kimble: Dev. Biol. 331, 14 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C01H6] 1369/1370-TAAAGCCAACAACAGCTTA-[C01H6] 1999/2000 (630 bp deletion + 19 bp insertion)
ChromosomeI
Putative gene structurejoin(complement(Z71258.1:1959..2103), complement(Z71258.1:1121..1608), complement(Z71258.1:106..281), complement(19019..19144), complement(18765..18906), complement(18475..18597))
Map position1.83
Balancer
Map position of balancer
Sequence of primersIntFwd:AGTGTGGGCTCATACCGGCT,IntRev:GCTCCAGCCCAATTCCCTAC,ExtFwd:TCCTGGTGGCATTCCGGTCA,ExtRev:GGGATGTCATCCATCCGATA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Rossillo M, Ringstad N.
Development of specialized sensory neurons engages a nuclear receptor required for functional plasticity.
Genes Dev 2020 34(23-24) 1666-1679 
[ PubMed ID = 33184226 ] [ RRC reference ]

Zhang A, Noma K, Yan D.
Regulation of Gliogenesis by lin-32/Atoh1 in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(9) 3271-3278 
[ PubMed ID = 32665354 ] [ RRC reference ]

Lee J, Taylor CA, Barnes KM, Shen A, Stewart EV, Chen A, Xiang YK, Bao Z, Shen K.
A Myt1 family transcription factor defines neuronal fate by repressing non-neuronal genes.
Elife 2019 8  
[ PubMed ID = 31386623 ] [ RRC reference ]

Rojo Romanos T, Pladevall-Morera D, Langebeck-Jensen K, Hansen S, Ng L, Pocock R.
LIN-32/Atonal Controls Oxygen Sensing Neuron Development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 7294 
[ PubMed ID = 28779171 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]

Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet 2016 12(8) e1006237 
[ PubMed ID = 27487365 ] [ RRC reference ]

Sallee MD, Greenwald I.
Dimerization-driven degradation of C. elegans and human E proteins.
Genes Dev 2015 29(13) 1356-61 
[ PubMed ID = 26159995 ] [ RRC reference ]

Zhu Z, Liu J, Yi P, Tian D, Chai Y, Li W, Ou G.
A proneural gene controls C. elegans neuroblast asymmetric division and migration.
FEBS Lett 2014 588(7) 1136-43 
[ PubMed ID = 24589937 ] [ RRC reference ]

Philogene MC, Small SG, Wang P, Corsi AK.
Distinct Caenorhabditis elegans HLH-8/twist-containing dimers function in the mesoderm.
Dev Dyn 2012 241(3) 481-92 
[ PubMed ID = 22275075 ] [ RRC reference ]

Schindler AJ, Sherwood DR.
The transcription factor HLH-2/E/Daughterless regulates anchor cell invasion across basement membrane in C. elegans.
Dev Biol 2011 357(2) 380-91 
[ PubMed ID = 21784067 ] [ RRC reference ]

Chesney MA, Lam N, Morgan DE, Phillips BT, Kimble J.
C. elegans HLH-2/E/Daughterless controls key regulatory cells during gonadogenesis.
Dev Biol 2009 331(1) 14-25 
[ PubMed ID = 19376107 ] [ RRC reference ]