分離済み変異体

tm1753

Allele Nametm1753
BalanceCompleted
OutCrossNot Accepted
Sequence NameY18D10A.17
Gene Namecar-1
Worm BaseAllele Name tm1753 (x1)
Gene Name car-1
Sequence Y18D10A.17
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. K. Oegema: J. Cell Biol.171, 267-279 (2005). Dr. J.G. White: Mol. Biol. Cell, 17, 336-344 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 124580/124581-125218/125219 (638 bp deletion)
ChromosomeI
Putative gene structurejoin(124186..124431, 124482..124671, 124724..125167, 125215..125357)
Map position14.18
Balancer,tmC27[tmIs1239]
Map position of balancer
Sequence of primersExtFwd:CCTTTAAATGGGATTGGGGT,IntFwd:GGGGTGCAGCGCCATTTTAG,ExtRev:ATATCGGGGTATGGGGATGT,IntRev:GGCAGTATTGCCTTGGTTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Tang NH, Kim KW, Xu S, Blazie SM, Yee BA, Yeo GW, Jin Y, Chisholm AD.
The mRNA Decay Factor CAR-1/LSM14 Regulates Axon Regeneration via Mitochondrial Calcium Dynamics.
Curr Biol 2020 30(5) 865-876.e7 
[ PubMed ID = 31983639 ] [ RRC reference ]

Moll L, Roitenberg N, Bejerano-Sagie M, Boocholez H, Carvalhal Marques F, Volovik Y, Elami T, Siddiqui AA, Grushko D, Biram A, Lampert B, Achache H, Ravid T, Tzur YB, Cohen E.
The insulin/IGF signaling cascade modulates SUMOylation to regulate aging and proteostasis in Caenorhabditis elegans.
Elife 2018 7  
[ PubMed ID = 30403374 ] [ RRC reference ]

Ko S, Kawasaki I, Shim YH.
PAB-1, a Caenorhabditis elegans poly(A)-binding protein, regulates mRNA metabolism in germline by interacting with CGH-1 and CAR-1.
PLoS One 2013 8(12) e84798 
[ PubMed ID = 24367695 ] [ RRC reference ]

Mikeladze-Dvali T, von Tobel L, Strnad P, Knott G, Leonhardt H, Schermelleh L, Gönczy P.
Analysis of centriole elimination during C. elegans oogenesis.
Development 2012 139(9) 1670-9 
[ PubMed ID = 22492357 ] [ RRC reference ]

Noble SL, Allen BL, Goh LK, Nordick K, Evans TC.
Maternal mRNAs are regulated by diverse P body-related mRNP granules during early Caenorhabditis elegans development.
J Cell Biol 2008 182(3) 559-72 
[ PubMed ID = 18695046 ] [ RRC reference ]

Squirrell JM, Eggers ZT, Luedke N, Saari B, Grimson A, Lyons GE, Anderson P, White JG.
CAR-1, a protein that localizes with the mRNA decapping component DCAP-1, is required for cytokinesis and ER organization in Caenorhabditis elegans embryos.
Mol Biol Cell 2006 17(1) 336-44 
[ PubMed ID = 16267265 ] [ RRC reference ]

Audhya A, Hyndman F, McLeod IX, Maddox AS, Yates JR 3rd, Desai A, Oegema K.
A complex containing the Sm protein CAR-1 and the RNA helicase CGH-1 is required for embryonic cytokinesis in Caenorhabditis elegans.
J Cell Biol 2005 171(2) 267-79 
[ PubMed ID = 16247027 ] [ RRC reference ]