| Allele Name | tm1750 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | ZK256.1 |
| Gene Name | pmr-1 |
| Worm Base | Allele Name |
tm1750
|
| Gene Name |
pmr-1
|
| Sequence |
ZK256.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| [CC4] 23461/23462-[CC4] 23714/23715 (253 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(Z81490.1:23740..24051, Z81490.1:24897..25127, Z81490.1:25190..25465, Z81490.1:26681..27254, Z81490.1:30707..31009, Z81490.1:31777..32063, 104..201, 1046..1310, 1948..2188, 2734..2852) |
| Map position | 17.16 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GACGGCGGCAATATTCCGAG,IntFwd:CCGAGTACAAGGTAACACTA,ExtRev:CCCATGAAGGCGATGCATGT,IntRev:CAACATCGGATCCGGTGGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Praitis V, Simske J, Kniss S, Mandt R, Imlay L, Feddersen C, Miller MB, Mushi J, Liszewski W, Weinstein R, Chakravorty A, Ha DG, Schacht Farrell A, Sullivan-Wilson A, Stock T. The secretory pathway calcium ATPase PMR-1/SPCA1 has essential roles in cell migration during Caenorhabditis elegans embryonic development. PLoS Genet 2013 9(5) e1003506
[ PubMed ID = 23696750 ]
[ RRC reference ]
|
Kourtis N, Nikoletopoulou V, Tavernarakis N. Small heat-shock proteins protect from heat-stroke-associated neurodegeneration. Nature 2012 490(7419) 213-8
[ PubMed ID = 22972192 ]
[ RRC reference ]
|
|