分離済み変異体

tm1748

Allele Nametm1748
BalanceNot Required
OutCrossNot Accepted
Sequence NameF54D5.1
Gene Namepcs-1
Worm BaseAllele Name tm1748
Gene Name pcs-1
Sequence F54D5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36918/36919-AAA-37506/37507 (588 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(35625..36355, 36408..36493, 36763..36874, 36933..37119))
Map position3.77
Balancer
Map position of balancer
Sequence of primersExtFwd:TCTTTAAAGGCGCATCCCGT,IntFwd:TTTCGAATGGCCACGCTATG,ExtRev:ATGCTACTACCATGCGGGAC,IntRev:CATGCCGACTCGAGCTGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K.
Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor.
Proc Natl Acad Sci U S A 2021 118(42)  
[ PubMed ID = 34649987 ] [ RRC reference ]

Winter SA, Dölling R, Knopf B, Mendelski MN, Schäfers C, Paul RJ.
Detoxification and sensing mechanisms are of similar importance for Cd resistance in Caenorhabditis elegans.
Heliyon 2016 2(10) e00183 
[ PubMed ID = 27822562 ] [ RRC reference ]

Essig YJ, Webb SM, Stürzenbaum SR.
Deletion of Phytochelatin Synthase Modulates the Metal Accumulation Pattern of Cadmium Exposed C. elegans.
Int J Mol Sci 2016 17(2) 257 
[ PubMed ID = 26907254 ] [ RRC reference ]

Polak N, Read DS, Jurkschat K, Matzke M, Kelly FJ, Spurgeon DJ, Stürzenbaum SR.
Metalloproteins and phytochelatin synthase may confer protection against zinc oxide nanoparticle induced toxicity in Caenorhabditis elegans.
Comp Biochem Physiol C Toxicol Pharmacol 2014 160 75-85 
[ PubMed ID = 24333255 ] [ RRC reference ]

Turner EA, Kroeger GL, Arnold MC, Thornton BL, Di Giulio RT, Meyer JN.
Assessing different mechanisms of toxicity in mountaintop removal/valley fill coal mining-affected watershed samples using Caenorhabditis elegans.
PLoS One 2013 8(9) e75329 
[ PubMed ID = 24066176 ] [ RRC reference ]

Hall J, Haas KL, Freedman JH.
Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans.
Toxicol Sci 2012 128(2) 418-26 
[ PubMed ID = 22552775 ] [ RRC reference ]

Schwartz MS, Benci JL, Selote DS, Sharma AK, Chen AG, Dang H, Fares H, Vatamaniuk OK.
Detoxification of multiple heavy metals by a half-molecule ABC transporter, HMT-1, and coelomocytes of Caenorhabditis elegans.
PLoS One 2010 5(3) e9564 
[ PubMed ID = 20221439 ] [ RRC reference ]

Hughes SL, Bundy JG, Want EJ, Kille P, Stürzenbaum SR.
The metabolomic responses of Caenorhabditis elegans to cadmium are largely independent of metallothionein status, but dominated by changes in cystathionine and phytochelatins.
J Proteome Res 2009 8(7) 3512-9 
[ PubMed ID = 19466807 ] [ RRC reference ]