分離済み変異体

tm1746

Allele Nametm1746
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0414.5
Gene Namecpb-3
Worm BaseAllele Name tm1746
Gene Name cpb-3
Sequence B0414.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Kimble: homozygotes are viable and fertile. Dr. M. Hengartner, Dr. D. Greenstein: increased germ cell apoptosis.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19085/19086-19653/19654 (568 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(17581..17792, 17868..18080, 18157..18757, 18814..18990, 19035..19964, 20012..20134))
Map position0.45
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGTGCTGACTGCGAATTAC,ExtFwd:CCGACAGAAACAGTGTGCTG,IntRev:GTGTAACATCGCGTCGTTCA,ExtRev:ACGATGCCCACTCGATAATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kisielnicka E, Minasaki R, Eckmann CR.
MAPK signaling couples SCF-mediated degradation of translational regulators to oocyte meiotic progression.
Proc Natl Acad Sci U S A 2018 115(12) E2772-E2781 
[ PubMed ID = 29496961 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv Exp Med Biol 2013 757 41-69 
[ PubMed ID = 22872474 ] [ RRC reference ]

Hasegawa E, Karashima T, Sumiyoshi E, Yamamoto M.
C. elegans CPB-3 interacts with DAZ-1 and functions in multiple steps of germline development.
Dev Biol 2006 295(2) 689-99 
[ PubMed ID = 16678151 ] [ RRC reference ]