分離済み変異体

tm1743

Allele Nametm1743
BalanceNot Required
OutCrossNot Accepted
Sequence NameF55A11.3
Gene Namesel-11
Worm BaseAllele Name tm1743
Gene Name sel-11
Sequence F55A11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: Healthy, no obvious Psa phenotype. Dr. T. Schedl: no germline phenotypes. Dr. A. Colavita: no VC axon branching defects but up-regulation of hsp-4::gfp. Dr. T. Ogura: Genes to Cells: 12, 1063 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4110/4111-CAAAGTTTCTTGTATATCTCATGTTCCAATTGCTCAAG-4583/4584 (473 bp deletion + 38 bp insertion)
ChromosomeV
Putative gene structurejoin(3919..4146, 4192..4624, 4928..5090, 5136..5323, 5376..5635, 5682..6242)
Map position3.33
Balancer
Map position of balancer
Sequence of primersExtRev:GCCTTCCATTCGACGAAGCT,IntFwd:GGTAGAACTCCGCCTGTGAT,ExtFwd:TGACCCGGAAATTGATGGTA,IntRev:GTAAGATGGGTTGACTGGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Oh KH, Xiong A, Choe JY, Richmond JE, Kim H.
Active Zone Trafficking of CaV2/UNC-2 Channels Is Independent of β/CCB-1 and α2δ/UNC-36 Subunits.
J Neurosci 2023 43(28) 5142-5157 
[ PubMed ID = 37160370 ] [ RRC reference ]

Oswald M, Hulsey-Vincent H, Dahlberg CL.
Mutations in two ERAD E3 ubiquitin ligase enzymes reduce spontaneous reversal frequency in Caenorhabditis elegans.
MicroPubl Biol 2020 2020  
[ PubMed ID = 33274327 ] [ RRC reference ]

Cheung TP, Choe JY, Richmond JE, Kim H.
BK channel density is regulated by endoplasmic reticulum associated degradation and influenced by the SKN-1A/NRF1 transcription factor.
PLoS Genet 2020 16(6) e1008829 
[ PubMed ID = 32502151 ] [ RRC reference ]

Lehrbach NJ, Ruvkun G.
Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1.
Elife 2016 5  
[ PubMed ID = 27528192 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]

Choi MS, Yoo AS, Greenwald I.
sel-11 and cdc-42, two negative modulators of LIN-12/Notch activity in C. elegans.
PLoS One 2010 5(7) e11885 
[ PubMed ID = 20686701 ] [ RRC reference ]

Habibi-Babadi N, Su A, de Carvalho CE, Colavita A.
The N-glycanase png-1 acts to limit axon branching during organ formation in Caenorhabditis elegans.
J Neurosci 2010 30(5) 1766-76 
[ PubMed ID = 20130186 ] [ RRC reference ]

Arur S, Ohmachi M, Nayak S, Hayes M, Miranda A, Hay A, Golden A, Schedl T.
Multiple ERK substrates execute single biological processes in Caenorhabditis elegans germ-line development.
Proc Natl Acad Sci U S A 2009 106(12) 4776-81 
[ PubMed ID = 19264959 ] [ RRC reference ]

Noble SL, Allen BL, Goh LK, Nordick K, Evans TC.
Maternal mRNAs are regulated by diverse P body-related mRNP granules during early Caenorhabditis elegans development.
J Cell Biol 2008 182(3) 559-72 
[ PubMed ID = 18695046 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73 
[ PubMed ID = 17825049 ] [ RRC reference ]