Home > 分離済み変異体 > tm1743

分離済み変異体

Allele Name		tm1743
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F55A11.3
Gene Name		sel-11
Worm Base	Allele Name	tm1743
	Gene Name	sel-11
	Sequence	F55A11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. H. Sawa: Healthy, no obvious Psa phenotype. Dr. T. Schedl: no germline phenotypes. Dr. A. Colavita: no VC axon branching defects but up-regulation of hsp-4::gfp. Dr. T. Ogura: Genes to Cells: 12, 1063 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4110/4111-CAAAGTTTCTTGTATATCTCATGTTCCAATTGCTCAAG-4583/4584 (473 bp deletion + 38 bp insertion)
Chromosome		V
Putative gene structure		join(3919..4146, 4192..4624, 4928..5090, 5136..5323, 5376..5635, 5682..6242)
Map position		3.33
Balancer
Map position of balancer
Sequence of primers		ExtRev:GCCTTCCATTCGACGAAGCT,IntFwd:GGTAGAACTCCGCCTGTGAT,ExtFwd:TGACCCGGAAATTGATGGTA,IntRev:GTAAGATGGGTTGACTGGTG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Oh KH, Xiong A, Choe JY, Richmond JE, Kim H. Active Zone Trafficking of CaV2/UNC-2 Channels Is Independent of β/CCB-1 and α2δ/UNC-36 Subunits. J Neurosci 2023 43(28) 5142-5157  [ PubMed ID = 37160370 ] [ RRC reference ] Oswald M, Hulsey-Vincent H, Dahlberg CL. Mutations in two ERAD E3 ubiquitin ligase enzymes reduce spontaneous reversal frequency in Caenorhabditis elegans. MicroPubl Biol 2020 2020   [ PubMed ID = 33274327 ] [ RRC reference ] Cheung TP, Choe JY, Richmond JE, Kim H. BK channel density is regulated by endoplasmic reticulum associated degradation and influenced by the SKN-1A/NRF1 transcription factor. PLoS Genet 2020 16(6) e1008829  [ PubMed ID = 32502151 ] [ RRC reference ] Lehrbach NJ, Ruvkun G. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife 2016 5   [ PubMed ID = 27528192 ] [ RRC reference ] Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG. Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance. J Neurosci 2015 35(42) 14286-306  [ PubMed ID = 26490867 ] [ RRC reference ] Choi MS, Yoo AS, Greenwald I. sel-11 and cdc-42, two negative modulators of LIN-12/Notch activity in C. elegans. PLoS One 2010 5(7) e11885  [ PubMed ID = 20686701 ] [ RRC reference ] Habibi-Babadi N, Su A, de Carvalho CE, Colavita A. The N-glycanase png-1 acts to limit axon branching during organ formation in Caenorhabditis elegans. J Neurosci 2010 30(5) 1766-76  [ PubMed ID = 20130186 ] [ RRC reference ] Arur S, Ohmachi M, Nayak S, Hayes M, Miranda A, Hay A, Golden A, Schedl T. Multiple ERK substrates execute single biological processes in Caenorhabditis elegans germ-line development. Proc Natl Acad Sci U S A 2009 106(12) 4776-81  [ PubMed ID = 19264959 ] [ RRC reference ] Noble SL, Allen BL, Goh LK, Nordick K, Evans TC. Maternal mRNAs are regulated by diverse P body-related mRNP granules during early Caenorhabditis elegans development. J Cell Biol 2008 182(3) 559-72  [ PubMed ID = 18695046 ] [ RRC reference ] Sasagawa Y, Yamanaka K, Ogura T. ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans. Genes Cells 2007 12(9) 1063-73  [ PubMed ID = 17825049 ] [ RRC reference ]