分離済み変異体

tm1741

Allele Nametm1741
BalanceCompleted
OutCrossNot Accepted
Sequence NameF36H2.1
Gene Nametat-5
Worm BaseAllele Name tm1741 (x1)
Gene Name tat-5
Sequence F36H2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M. Han: Let and Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4254/4255-4646/4647 (392 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(AL021466.1:5183..5371, 129..277, 324..580, 1366..1940, 2420..3017, 3365..3701, 4144..4390, 4445..4954, 5355..5514, 6300..6502))
Map position3.71
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntFwd:CGACCAATTTGCCACGAGTA,ExtFwd:CGGAATATGCTTGTCACGAC,IntRev:GGCGACGTGTTCTGCACTCA,ExtRev:CCGAACTGCGCCAGCATTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Maniates KA, Suryanarayanan S, Rumin A, Lewin M, Singson A, Wehman AM.
Sperm activation for fertilization requires robust activity of the TAT-5 lipid flippase.
Dev Biol 2025 528 66-78 
[ PubMed ID = 40915529 ] [ RRC reference ]

Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD.
Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology.
Curr Biol 2024 34(21) 4920-4933.e11 
[ PubMed ID = 39378880 ] [ RRC reference ]

Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD.
Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology.
bioRxiv 2024   
[ PubMed ID = 38766017 ] [ RRC reference ]

Pitts LR, Nguyen AT, Wehman AM.
Conserved N- and C-terminal motifs of PAD-1 are required to inhibit extracellular vesicle release.
MicroPubl Biol 2022 2022  
[ PubMed ID = 36188098 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Wehman AM, Poggioli C, Schweinsberg P, Grant BD, Nance J.
The P4-ATPase TAT-5 inhibits the budding of extracellular vesicles in C. elegans embryos.
Curr Biol 2011 21(23) 1951-9 
[ PubMed ID = 22100064 ] [ RRC reference ]

Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA.
An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases.
BMC Dev Biol 2008 8 96 
[ PubMed ID = 18831765 ] [ RRC reference ]