| Allele Name | tm1741 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F36H2.1 |
| Gene Name | tat-5 |
| Worm Base | Allele Name |
tm1741
(x1) |
| Gene Name |
tat-5
|
| Sequence |
F36H2.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. M. Han: Let and Ste. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 4254/4255-4646/4647 (392 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(AL021466.1:5183..5371, 129..277, 324..580, 1366..1940, 2420..3017, 3365..3701, 4144..4390, 4445..4954, 5355..5514, 6300..6502)) |
| Map position | 3.71 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntFwd:CGACCAATTTGCCACGAGTA,ExtFwd:CGGAATATGCTTGTCACGAC,IntRev:GGCGACGTGTTCTGCACTCA,ExtRev:CCGAACTGCGCCAGCATTAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Maniates KA, Suryanarayanan S, Rumin A, Lewin M, Singson A, Wehman AM. Sperm activation for fertilization requires robust activity of the TAT-5 lipid flippase. Dev Biol 2025 528 66-78
[ PubMed ID = 40915529 ]
[ RRC reference ]
|
Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD. Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology. Curr Biol 2024 34(21) 4920-4933.e11
[ PubMed ID = 39378880 ]
[ RRC reference ]
|
Park S, Noblett N, Pitts L, Colavita A, Wehman AM, Jin Y, Chisholm AD. Dopey-dependent regulation of extracellular vesicles maintains neuronal morphology. bioRxiv 2024
[ PubMed ID = 38766017 ]
[ RRC reference ]
|
Pitts LR, Nguyen AT, Wehman AM. Conserved N- and C-terminal motifs of PAD-1 are required to inhibit extracellular vesicle release. MicroPubl Biol 2022 2022
[ PubMed ID = 36188098 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Wehman AM, Poggioli C, Schweinsberg P, Grant BD, Nance J. The P4-ATPase TAT-5 inhibits the budding of extracellular vesicles in C. elegans embryos. Curr Biol 2011 21(23) 1951-9
[ PubMed ID = 22100064 ]
[ RRC reference ]
|
Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA. An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases. BMC Dev Biol 2008 8 96
[ PubMed ID = 18831765 ]
[ RRC reference ]
|
|