分離済み変異体

tm1734

Allele Nametm1734
BalanceNot Required
OutCrossNot Accepted
Sequence NameC42D8.4
Gene Nameets-5
Worm BaseAllele Name tm1734
Gene Name ets-5
Sequence C42D8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Hobert: Nature. 2009 458:885.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2369/2370-2887/2888 (518 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(830..895, 943..1052, 1105..1243, 2314..2386, 2436..2674))
Map position-6.2
Balancer
Map position of balancer
Sequence of primersExtRev:CTGGGGGTAAGCCTATCATA,IntRev:GATTAAATCCTCGCCGACGA,ExtFwd:CGATCACATCGCGATGTTAT,IntFwd:GTACTTCAAATACAGACCGC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Godini R, Pocock R.
Characterization of the Doublesex/MAB-3 transcription factor DMD-9 in Caenorhabditis elegans.
G3 (Bethesda) 2023 13(2)  
[ PubMed ID = 36454093 ] [ RRC reference ]

Handley A, Wu Q, Sherry T, Cornell R, Pocock R.
Diet-responsive transcriptional regulation of insulin in a single neuron controls systemic metabolism.
PLoS Biol 2022 20(5) e3001655 
[ PubMed ID = 35594303 ] [ RRC reference ]

Rossillo M, Ringstad N.
Development of specialized sensory neurons engages a nuclear receptor required for functional plasticity.
Genes Dev 2020 34(23-24) 1666-1679 
[ PubMed ID = 33184226 ] [ RRC reference ]

Horowitz LB, Brandt JP, Ringstad N.
Repression of an activity-dependent autocrine insulin signal is required for sensory neuron development in C. elegans.
Development 2019 146(22)  
[ PubMed ID = 31628111 ] [ RRC reference ]

Brandt JP, Rossillo M, Du Z, Ichikawa D, Barnes K, Chen A, Noyes M, Bao Z, Ringstad N.
Lineage context switches the function of a C. elegans Pax6 homolog in determining a neuronal fate.
Development 2019 146(8)  
[ PubMed ID = 30890567 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6  
[ PubMed ID = 28422646 ] [ RRC reference ]

Juozaityte V, Pladevall-Morera D, Podolska A, Nørgaard S, Neumann B, Pocock R.
The ETS-5 transcription factor regulates activity states in Caenorhabditis elegans by controlling satiety.
Proc Natl Acad Sci U S A 2017 114(9) E1651-E1658 
[ PubMed ID = 28193866 ] [ RRC reference ]

Rojo Romanos T, Petersen JG, Riveiro AR, Pocock R.
A novel role for the zinc-finger transcription factor EGL-46 in the differentiation of gas-sensing neurons in Caenorhabditis elegans.
Genetics 2015 199(1) 157-63 
[ PubMed ID = 25395666 ] [ RRC reference ]

Sharabi K, Charar C, Friedman N, Mizrahi I, Zaslaver A, Sznajder JI, Gruenbaum Y.
The response to high CO2 levels requires the neuropeptide secretion component HID-1 to promote pumping inhibition.
PLoS Genet 2014 10(8) e1004529 
[ PubMed ID = 25101962 ] [ RRC reference ]

Serrano-Saiz E, Poole RJ, Felton T, Zhang F, De La Cruz ED, Hobert O.
Modular control of glutamatergic neuronal identity in C. elegans by distinct homeodomain proteins.
Cell 2013 155(3) 659-73 
[ PubMed ID = 24243022 ] [ RRC reference ]

Gramstrup Petersen J, Rojo Romanos T, Juozaityte V, Redo Riveiro A, Hums I, Traunmüller L, Zimmer M, Pocock R.
EGL-13/SoxD specifies distinct O2 and CO2 sensory neuron fates in Caenorhabditis elegans.
PLoS Genet 2013 9(5) e1003511 
[ PubMed ID = 23671427 ] [ RRC reference ]

Guillermin ML, Castelletto ML, Hallem EA.
Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor.
Genetics 2011 189(4) 1327-39 
[ PubMed ID = 21954162 ] [ RRC reference ]

Flames N, Hobert O.
Gene regulatory logic of dopamine neuron differentiation.
Nature 2009 458(7240) 885-9 
[ PubMed ID = 19287374 ] [ RRC reference ]