| Allele Name | tm1726 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y17G7B.2 |
| Gene Name | ash-2 |
| Worm Base | Allele Name |
tm1726
|
| Gene Name |
ash-2
|
| Sequence |
Y17G7B.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 12371/12372-12840/12841 (469 bp deletion) |
| Chromosome | II |
| Putative gene structure | join(11683..11753, 11836..11928, 11980..12304, 13242..13462, 14218..14331, 15865..16127, 17187..17299, 18228..18428, 18624..18714, 19438..19658) |
| Map position | 5.54 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TTCGACGGCGAGGCGATTGT,IntFwd:GTCGCGGTCGATAAGCACTC,ExtRev:CGTGGCTCACGGTTTTCCCT,IntRev:CTGCCTCGTGTAGTGGTCCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Huang X, Ye Q, Dai W, Zheng J, Li Y, Wang C, Luo Z, Yang J, Zhuo W, Wan QL.
Cadmium exposure induces multigenerational inheritance of germ cell apoptosis and fertility suppression in Caenorhabditis elegans.
Environ Int 2024 191 108952
[ PubMed ID = 39159515 ]
[ RRC reference ]
|
Wan QL, Meng X, Wang C, Dai W, Luo Z, Yin Z, Ju Z, Fu X, Yang J, Ye Q, Zhang ZH, Zhou Q.
Histone H3K4me3 modification is a transgenerational epigenetic signal for lipid metabolism in Caenorhabditis elegans.
Nat Commun 2022 13(1) 768
[ PubMed ID = 35140229 ]
[ RRC reference ]
|
Chow YL, Sato F.
Transgenerational lipid-reducing activity of benzylisoquinoline alkaloids in Caenorhabditis elegans.
Genes Cells 2019 24(1) 70-81
[ PubMed ID = 30451341 ]
[ RRC reference ]
|
Yu Y, Zhi L, Guan X, Wang D, Wang D.
FLP-4 neuropeptide and its receptor in a neuronal circuit regulate preference choice through functions of ASH-2 trithorax complex in Caenorhabditis elegans.
Sci Rep 2016 6 21485
[ PubMed ID = 26887501 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.