分離済み変異体

tm1724

Allele Nametm1724
BalanceNot Required
OutCrossNot Accepted
Sequence NameT28F3.6
Gene Nameifta-2
Worm BaseAllele Name tm1724
Gene Name ifta-2
Sequence T28F3.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Sengupta: normal dye filling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20979/20980-CACTCCTCGATCAGAATCTGTCATGATTGTCTCTTGCTCCTG-21763/21764 (784 bp deletion + 42 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(20593..20773, 20825..21028, 21205..21328, 21409..21544, 21656..21769))
Map position16.45
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGGAGGCTCTTGATTGGGT,ExtFwd:AACCTTCACTATCGGAGGCT,IntRev:GTAGCCGGCGAGTTCACTGT,ExtRev:CTGCGTACCGGGAACTTTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Vermezovic J, Stergiou L, Hengartner MO, d'Adda di Fagagna F.
Differential regulation of DNA damage response activation between somatic and germline cells in Caenorhabditis elegans.
Cell Death Differ 2012 19(11) 1847-55 
[ PubMed ID = 22705849 ] [ RRC reference ]

Schafer JC, Winkelbauer ME, Williams CL, Haycraft CJ, Desmond RA, Yoder BK.
IFTA-2 is a conserved cilia protein involved in pathways regulating longevity and dauer formation in Caenorhabditis elegans.
J Cell Sci 2006 119(Pt 19) 4088-100 
[ PubMed ID = 16968739 ] [ RRC reference ]