分離済み変異体

tm1714

Allele Name

tm1714

Balance

Not Required

OutCross

Not Accepted

Sequence Name

Y47D3A.16

Gene Name

rsks-1

Worm Base

Allele Name

tm1714

Gene Name

rsks-1

Sequence

Y47D3A.16

Phenotype

homozygous viable. Dr. S. Tuck, Dr. K. Ashrafi, Dr. G. Ruvkun: reduced body size.

Mutation site

112117/112118-TTT-112601/112602 (484 bp deletion + 3 bp insertion)

Chromosome

III

Putative gene structure

join(109161..109225, 110205..110268, 110701..110859, 111868..112904, 113946..114269, 114942..115035)

Map position

7.72

Balancer

Map position of balancer

Sequence of primers

IntRev:GTGCCACCGAAATTCCACCA,ExtRev:GCAGCACCAGCTCTCGACAT,IntFwd:TGCCAGTGCAATTAATCCAC,ExtFwd:CTCATCGTATATGGAGGATC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854
[ PubMed ID = 38878153 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023
[ PubMed ID = 38045350 ] [ RRC reference ]

Tsai YT, Chang CH, Tsai HY.
Rege-1 promotes C. elegans survival by modulating IIS and TOR pathways.
PLoS Genet 2023 19(8) e1010869
[ PubMed ID = 37556491 ] [ RRC reference ]

Hahm JH, Nirmala FS, Choi PG, Seo HD, Ha TY, Jung CH, Ahn J.
The innate immune signaling component FBXC-58 mediates dietary restriction effects on healthy aging in Caenorhabditis elegans.
Aging (Albany NY) 2023 15(1) 21-36
[ PubMed ID = 36622277 ] [ RRC reference ]

Lee J, Kim SS, Lee SV.
A mutation that alters the 255th glutamate to lysine in RSKS-1/S6 kinase reliably extends the lifespan of C. elegans.
MicroPubl Biol 2020 2020
[ PubMed ID = 33274335 ] [ RRC reference ]

Son HG, Seo K, Seo M, Park S, Ham S, An SWA, Choi ES, Lee Y, Baek H, Kim E, Ryu Y, Ha CM, Hsu AL, Roh TY, Jang SK, Lee SV.
Prefoldin 6 mediates longevity response from heat shock factor 1 to FOXO in C. elegans.
Genes Dev 2018 32(23-24) 1562-1575
[ PubMed ID = 30478249 ] [ RRC reference ]

Hubert T, Wu Z, Chisholm AD, Jin Y.
S6 kinase inhibits intrinsic axon regeneration capacity via AMP kinase in Caenorhabditis elegans.
J Neurosci 2014 34(3) 758-63
[ PubMed ID = 24431434 ] [ RRC reference ]

Chen D, Li PW, Goldstein BA, Cai W, Thomas EL, Chen F, Hubbard AE, Melov S, Kapahi P.
Germline signaling mediates the synergistically prolonged longevity produced by double mutations in daf-2 and rsks-1 in C. elegans.
Cell Rep 2013 5(6) 1600-10
[ PubMed ID = 24332851 ] [ RRC reference ]

Seo K, Choi E, Lee D, Jeong DE, Jang SK, Lee SJ.
Heat shock factor 1 mediates the longevity conferred by inhibition of TOR and insulin/IGF-1 signaling pathways in C. elegans.
Aging Cell 2013 12(6) 1073-81
[ PubMed ID = 23879233 ] [ RRC reference ]

Nukazuka A, Tamaki S, Matsumoto K, Oda Y, Fujisawa H, Takagi S.
A shift of the TOR adaptor from Rictor towards Raptor by semaphorin in C. elegans.
Nat Commun 2011 2 484
[ PubMed ID = 21952218 ] [ RRC reference ]