分離済み変異体

tm1711

Allele Nametm1711
BalanceNot Required
OutCrossNot Accepted
Sequence NameF42G9.7
Gene Namesnt-2
Worm BaseAllele Name tm1711
Gene Name snt-2
Sequence F42G9.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Hermann: wild-type gut granules.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31884/31885-32746/32747 (862 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30884..31000, 31505..31606, 31653..31786, 32393..32513, 33497..33667, 33710..33838))
Map position-26.01
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCATCATTTCAGCCCACTG,IntFwd:GCACGCGTGGGTGATCTGAA,ExtRev:GACCCCAAATCTCATAGTCA,IntRev:TCTAGTGGCTGGCCTCACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Okahata M, Sawada N, Nakao K, Ohta A, Kuhara A.
Screening for cold tolerance genes in C. elegans, whose expressions are affected by anticancer drugs camptothecin and leptomycin B.
Sci Rep 2024 14(1) 5401 
[ PubMed ID = 38443452 ] [ RRC reference ]

Kim S, Sieburth D.
A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans.
Genetics 2019 211(4) 1283-1295 
[ PubMed ID = 30782598 ] [ RRC reference ]

Kim S, Sieburth D.
Sphingosine Kinase Regulates Neuropeptide Secretion During the Oxidative Stress-Response Through Intertissue Signaling.
J Neurosci 2018 38(38) 8160-8176 
[ PubMed ID = 30082417 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]

Wang H, Girskis K, Janssen T, Chan JP, Dasgupta K, Knowles JA, Schoofs L, Sieburth D.
Neuropeptide secreted from a pacemaker activates neurons to control a rhythmic behavior.
Curr Biol 2013 23(9) 746-54 
[ PubMed ID = 23583549 ] [ RRC reference ]

Mullen GP, Grundahl KM, Gu M, Watanabe S, Hobson RJ, Crowell JA, McManus JR, Mathews EA, Jorgensen EM, Rand JB.
UNC-41/stonin functions with AP2 to recycle synaptic vesicles in Caenorhabditis elegans.
PLoS One 2012 7(7) e40095 
[ PubMed ID = 22808098 ] [ RRC reference ]