| Allele Name | tm1703 |
| Allele Type | 通常株 |
| Sequence Name | F19H8.3 |
| Gene Name | arl-3 |
| Worm Base | Allele Name |
tm1703
|
| Gene Name |
arl-3
|
| Sequence |
F19H8.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. P. Sengupta: dyf+ in all sensory neurons. Dr. M. Leroux: Dyf normal. Dr. M. Barr: male mating behavior: slightly Lov defective. Dr. M. Han: wild-type (growth rate, brood size, vulva). Dr. K. Shen: Post- and pre-synaptic sites develp normal in AVE as determined by GLR-1::YFP and CFP::RAB-3 localization. Dr. O. Blacque: normal dye filling and normal osmolarity sensing. Dr. S. Eimer: normal levamisole receptor trafficking. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 10372/10373-GTCTCGACAACGCTTCTCTCGACAACGCCG-11267/11268 (895 bp deletion + 30 bp insertion) |
| Chromosome | II |
| Putative gene structure | join(10283..10710, 10996..11122) |
| Map position | 23.17 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TAACGCAAGGCTTACACTTG,IntFwd:GGCAGGCACCAAGTTTTACT,ExtRev:AGAGCAGCTCAACGGCCTAA,IntRev:GTGAGCTGATGAGTGTCTGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Akella JS, Carter SP, Nguyen K, Tsiropoulou S, Moran AL, Silva M, Rizvi F, Kennedy BN, Hall DH, Barr MM, Blacque OE.
Ciliary Rab28 and the BBSome negatively regulate extracellular vesicle shedding.
Elife 2020 9
[ PubMed ID = 32101165 ]
[ RRC reference ]
|
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198
[ PubMed ID = 27306325 ]
[ RRC reference ]
|
Li Y, Wei Q, Zhang Y, Ling K, Hu J.
The small GTPases ARL-13 and ARL-3 coordinate intraflagellar transport and ciliogenesis.
J Cell Biol 2010 189(6) 1039-51
[ PubMed ID = 20530210 ]
[ RRC reference ]
|
Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95
[ PubMed ID = 23886944 ]
[ RRC reference ]
|
Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84
[ PubMed ID = 24646679 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.