Home > 分離済み変異体 > tm1688

分離済み変異体

Allele Name		tm1688
Balance		Not Required
OutCross		Not Accepted
Sequence Name		T24B8.6
Gene Name		hlh-3
Worm Base	Allele Name	tm1688
	Gene Name	hlh-3
	Sequence	T24B8.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		35589/35590-36831/36832 (1242 bp deletion)
Chromosome		II
Putative gene structure		join(35567..35662, 36199..36396, 36888..37205)
Map position		1
Balancer
Map position of balancer
Sequence of primers		IntRev:GGGGATATACGGGAGACTGT,ExtFwd:CAAGGGCTCAAGTGAGCGTG,IntFwd:GCCGGCAAAAAGCACTAGTC,ExtRev:GTAGCTTGGCGATGGAGTCT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Bordet G, Couillault C, Soulavie F, Filippopoulou K, Bertrand V. PRC1 chromatin factors strengthen the consistency of neuronal cell fate specification and maintenance in C. elegans. PLoS Genet 2022 18(5) e1010209  [ PubMed ID = 35604893 ] [ RRC reference ] Filippopoulou K, Couillault C, Bertrand V. Multiple neural bHLHs ensure the precision of a neuronal specification event in Caenorhabditis elegans. Biol Open 2021 10(12)   [ PubMed ID = 34854469 ] [ RRC reference ] Perez LM, Alfonso A. The Conserved ASCL1/MASH-1 Ortholog HLH-3 Specifies Sex-Specific Ventral Cord Motor Neuron Fate in Caenorhabditis elegans. G3 (Bethesda) 2020 10(11) 4201-4213  [ PubMed ID = 32973001 ] [ RRC reference ] Masoudi N, Tavazoie S, Glenwinkel L, Ryu L, Kim K, Hobert O. Unconventional function of an Achaete-Scute homolog as a terminal selector of nociceptive neuron identity. PLoS Biol 2018 16(4) e2004979  [ PubMed ID = 29672507 ] [ RRC reference ] Lloret-Fernández C, Maicas M, Mora-Martínez C, Artacho A, Jimeno-Martín Á, Chirivella L, Weinberg P, Flames N. A transcription factor collective defines the HSN serotonergic neuron regulatory landscape. Elife 2018 7   [ PubMed ID = 29553368 ] [ RRC reference ] Li Y, Zhao D, Horie T, Chen G, Bao H, Chen S, Liu W, Horie R, Liang T, Dong B, Feng Q, Tao Q, Liu X. Conserved gene regulatory module specifies lateral neural borders across bilaterians. Proc Natl Acad Sci U S A 2017 114(31) E6352-E6360  [ PubMed ID = 28716930 ] [ RRC reference ] Sallee MD, Littleford HE, Greenwald I. A bHLH Code for Sexually Dimorphic Form and Function of the C. elegans Somatic Gonad. Curr Biol 2017 27(12) 1853-1860.e5  [ PubMed ID = 28602651 ] [ RRC reference ] Luo S, Horvitz HR. The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage. Curr Biol 2017 27(5) 661-672  [ PubMed ID = 28238659 ] [ RRC reference ] Murgan S, Kari W, Rothbächer U, Iché-Torres M, Mélénec P, Hobert O, Bertrand V. Atypical Transcriptional Activation by TCF via a Zic Transcription Factor in C. elegans Neuronal Precursors. Dev Cell 2015 33(6) 737-45  [ PubMed ID = 26073017 ] [ RRC reference ] Doonan R, Hatzold J, Raut S, Conradt B, Alfonso A. HLH-3 is a C. elegans Achaete/Scute protein required for differentiation of the hermaphrodite-specific motor neurons. Mech Dev 2008 125(9-10) 883-93  [ PubMed ID = 18586090 ] [ RRC reference ]