分離済み変異体

tm1670

Allele Nametm1670
BalanceNot Required
OutCrossNot Accepted
Sequence NameF57B10.6
Gene Namexpg-1
Worm BaseAllele Name tm1670
Gene Name xpg-1
Sequence F57B10.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. W. Vermeulen: normal locomotion but UV sensitive. Dr. S. Boulton: not sensitive to ionizing radiation. not Him, does not genetically interact with him-9 or him-6. Dr.M. Hengartner: defective in UV induced apoptosis.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10444/10445-11377/11378 (933 bp deletion)
ChromosomeI
Putative gene structurejoin(10316..10403, 10538..10803, 11239..11565, 11621..11704, 11962..12397, 12445..12918, 12969..13129, 13176..13307, 13394..13915)
Map position1.21
Balancer
Map position of balancer
Sequence of primersExtRev:TCTGGTCCAGTTACGTTGAT,IntFwd:ACGGAGATCAATTTGCATCC,IntRev:GAGTATCCACCTGTGGAGGT,ExtFwd:GGTTGGACAAATGGCGTTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752 
[ PubMed ID = 39966347 ] [ RRC reference ]

Rieckher M, Gallrein C, Alquezar-Artieda N, Bourached-Silva N, Vaddavalli PL, Mares D, Backhaus M, Blindauer T, Greger K, Wiesner E, Pontel LB, Schumacher B.
Distinct DNA repair mechanisms prevent formaldehyde toxicity during development, reproduction and aging.
Nucleic Acids Res 2024 52(14) 8271-8285 
[ PubMed ID = 38894680 ] [ RRC reference ]

Muniesa-Vargas A, Davó-Martínez C, Ribeiro-Silva C, van der Woude M, Thijssen KL, Haspels B, Häckes D, Kaynak ÜU, Kanaar R, Marteijn JA, Theil AF, Kuijten MMP, Vermeulen W, Lans H.
Persistent TFIIH binding to non-excised DNA damage causes cell and developmental failure.
Nat Commun 2024 15(1) 3490 
[ PubMed ID = 38664429 ] [ RRC reference ]

Hicks T, Koury E, McCabe C, Williams C, Crahan C, Smolikove S.
R-loop-induced irreparable DNA damage evades checkpoint detection in the C. elegans germline.
Nucleic Acids Res 2022 50(14) 8041-8059 
[ PubMed ID = 35871299 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ 2011 18(5) 897-906 
[ PubMed ID = 21151025 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]

Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]