分離済み変異体

tm1661

Allele Nametm1661
BalanceNot Required
OutCrossNot Accepted
Sequence NameY47G6A.2
Gene Nameinx-22
Worm BaseAllele Name tm1661
Gene Name inx-22
Sequence Y47G6A.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: Some die in embryonic stage (51/100). Dr. C. Bargmann: healthy, normal brood size. Dr. M. Miller: Dev. Biol. 301, 432 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 176421/176422-177186/177187 (765 bp deletion)
ChromosomeI
Putative gene structurejoin(175775..175860, 175925..175976, 176023..176276, 176330..176759, 176809..176895, 177533..177999, 178913..178991, 179039..179110)
Map position-3.14
Balancer
Map position of balancer
Sequence of primersExtRev:TGTGGGAGAATGCAGCGCAT,IntRev:GCAGCGCATGATGAACTCGT,ExtFwd:TTCCGCATTCGCCTCGCCAT,IntFwd:ACGCGTCATGCTGACTCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H.
A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway.
Front Immunol 2023 14 1249436 
[ PubMed ID = 37928537 ] [ RRC reference ]

Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI.
Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272 
[ PubMed ID = 28143932 ] [ RRC reference ]

Cinquin A, Chiang M, Paz A, Hallman S, Yuan O, Vysniauskaite I, Fowlkes CC, Cinquin O.
Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line.
PLoS Genet 2016 12(4) e1005985 
[ PubMed ID = 27077385 ] [ RRC reference ]

Starich TA, Hall DH, Greenstein D.
Two classes of gap junction channels mediate soma-germline interactions essential for germline proliferation and gametogenesis in Caenorhabditis elegans.
Genetics 2014 198(3) 1127-53 
[ PubMed ID = 25195067 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW.
Six innexins contribute to electrical coupling of C. elegans body-wall muscle.
PLoS One 2013 8(10) e76877 
[ PubMed ID = 24130800 ] [ RRC reference ]

Kim S, Govindan JA, Tu ZJ, Greenstein D.
SACY-1 DEAD-Box helicase links the somatic control of oocyte meiotic maturation to the sperm-to-oocyte switch and gamete maintenance in Caenorhabditis elegans.
Genetics 2012 192(3) 905-28 
[ PubMed ID = 22887816 ] [ RRC reference ]

Edmonds JW, McKinney SL, Prasain JK, Miller MA.
The gap junctional protein INX-14 functions in oocyte precursors to promote C. elegans sperm guidance.
Dev Biol 2011 359(1) 47-58 
[ PubMed ID = 21889935 ] [ RRC reference ]

Zhang C, Montgomery TA, Gabel HW, Fischer SE, Phillips CM, Fahlgren N, Sullivan CM, Carrington JC, Ruvkun G.
mut-16 and other mutator class genes modulate 22G and 26G siRNA pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(4) 1201-8 
[ PubMed ID = 21245313 ] [ RRC reference ]

Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev Biol 2010 342(1) 96-107 
[ PubMed ID = 20380830 ] [ RRC reference ]

Nadarajan S, Govindan JA, McGovern M, Hubbard EJ, Greenstein D.
MSP and GLP-1/Notch signaling coordinately regulate actomyosin-dependent cytoplasmic streaming and oocyte growth in C. elegans.
Development 2009 136(13) 2223-34 
[ PubMed ID = 19502484 ] [ RRC reference ]

Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D.
Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans.
Development 2009 136(13) 2211-21 
[ PubMed ID = 19502483 ] [ RRC reference ]

Whitten SJ, Miller MA.
The role of gap junctions in Caenorhabditis elegans oocyte maturation and fertilization.
Dev Biol 2007 301(2) 432-46 
[ PubMed ID = 16982048 ] [ RRC reference ]

Govindan JA, Cheng H, Harris JE, Greenstein D.
Galphao/i and Galphas signaling function in parallel with the MSP/Eph receptor to control meiotic diapause in C. elegans.
Curr Biol 2006 16(13) 1257-68 
[ PubMed ID = 16824915 ] [ RRC reference ]