| Allele Name | tm1642 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | B0336.7 |
| Gene Name | B0336.7 |
| Worm Base | Allele Name |
tm1642
(x1) |
| Gene Name |
B0336.7
|
| Sequence |
B0336.7
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. H. Zhang: accumulation of several germline P granule components in somatic cells. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10165/10166-10595/10596 (430 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(7760..8231, 8676..9127, 9401..9609, 9741..9887, 10050..10266, 10316..10324)) |
| Map position | -1.45 |
| Balancer | hT2,hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntRev:CAGACGCTATCCCGATGTTA,IntFwd:GCTTTACAGCGGGCTCCCAT,ExtRev:ATATCGCAGATGCGCCAGTT,ExtFwd:TCGACAACTCAAACACGCGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85
[ PubMed ID = 27396362 ]
[ RRC reference ]
|
Zhang Y, Yan L, Zhou Z, Yang P, Tian E, Zhang K, Zhao Y, Li Z, Song B, Han J, Miao L, Zhang H.
SEPA-1 mediates the specific recognition and degradation of P granule components by autophagy in C. elegans.
Cell 2009 136(2) 308-21
[ PubMed ID = 19167332 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.