分離済み変異体

tm1624

Allele Nametm1624
BalanceNot Required
OutCrossNot Accepted
Sequence NameK08H2.6
Gene Namehpl-1
Worm BaseAllele Name tm1624
Gene Name hpl-1
Sequence K08H2.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Han: without obvious phenotype at 20C. Dr. W. Vermeulen: hpl-1 (tm1624) hpl-2 (tm1489) double mutant shows severe UV sensitivity.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20665/20666-AA-21161/21162 (496 bp deletion + 2 bp insertion)
ChromosomeX
Putative gene structurejoin(20433..20525, 20601..20684, 20738..20827, 20880..21082, 21756..21840)
Map position10.52
Balancer
Map position of balancer
Sequence of primersIntRev:CTTAGGTTCTTTGGGGCGAG,ExtRev:GCAAGAAATCCCTTGCGACT,IntFwd:CAAGGGCAATCGCAGATGAG,ExtFwd:GGGGATACGGCTCATTAAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang M, Hong M, Hou X, Zhu C, Chen D, Chen X, Guang S, Feng X.
H3K9me1/2 methylation limits the lifespan of daf-2 mutants in C. elegans.
Elife 2022 11  
[ PubMed ID = 36125117 ] [ RRC reference ]

Rodriguez-Crespo D, Nanchen M, Rajopadhye S, Wicky C.
The zinc-finger transcription factor LSL-1 is a major regulator of the germline transcriptional program in Caenorhabditis elegans.
Genetics 2022 221(1)  
[ PubMed ID = 35262739 ] [ RRC reference ]

Snyder MJ, Lau AC, Brouhard EA, Davis MB, Jiang J, Sifuentes MH, Csankovszki G.
Anchoring of Heterochromatin to the Nuclear Lamina Reinforces Dosage Compensation-Mediated Gene Repression.
PLoS Genet 2016 12(9) e1006341 
[ PubMed ID = 27690361 ] [ RRC reference ]

Mao H, Zhu C, Zong D, Weng C, Yang X, Huang H, Liu D, Feng X, Guang S.
The Nrde Pathway Mediates Small-RNA-Directed Histone H3 Lysine 27 Trimethylation in Caenorhabditis elegans.
Curr Biol 2015 25(18) 2398-403 
[ PubMed ID = 26365259 ] [ RRC reference ]

Zhuang JJ, Banse SA, Hunter CP.
The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans.
Genetics 2013 194(1) 117-31 
[ PubMed ID = 23457236 ] [ RRC reference ]

Zheng C, Karimzadegan S, Chiang V, Chalfie M.
Histone methylation restrains the expression of subtype-specific genes during terminal neuronal differentiation in Caenorhabditis elegans.
PLoS Genet 2013 9(12) e1004017 
[ PubMed ID = 24348272 ] [ RRC reference ]

Studencka M, Wesołowski R, Opitz L, Salinas-Riester G, Wisniewski JR, Jedrusik-Bode M.
Transcriptional repression of Hox genes by C. elegans HP1/HPL and H1/HIS-24.
PLoS Genet 2012 8(9) e1002940 
[ PubMed ID = 23028351 ] [ RRC reference ]

Shirayama M, Seth M, Lee HC, Gu W, Ishidate T, Conte D Jr, Mello CC.
piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.
Cell 2012 150(1) 65-77 
[ PubMed ID = 22738726 ] [ RRC reference ]

Studencka M, Konzer A, Moneron G, Wenzel D, Opitz L, Salinas-Riester G, Bedet C, Krüger M, Hell SW, Wisniewski JR, Schmidt H, Palladino F, Schulze E, Jedrusik-Bode M.
Novel roles of Caenorhabditis elegans heterochromatin protein HP1 and linker histone in the regulation of innate immune gene expression.
Mol Cell Biol 2012 32(2) 251-65 
[ PubMed ID = 22083954 ] [ RRC reference ]

Meister P, Schott S, Bedet C, Xiao Y, Rohner S, Bodennec S, Hudry B, Molin L, Solari F, Gasser SM, Palladino F.
Caenorhabditis elegans Heterochromatin protein 1 (HPL-2) links developmental plasticity, longevity and lipid metabolism.
Genome Biol 2011 12(12) R123 
[ PubMed ID = 22185090 ] [ RRC reference ]

Yuen KW, Nabeshima K, Oegema K, Desai A.
Rapid de novo centromere formation occurs independently of heterochromatin protein 1 in C. elegans embryos.
Curr Biol 2011 21(21) 1800-7 
[ PubMed ID = 22018540 ] [ RRC reference ]

Koester-Eiserfunke N, Fischle W.
H3K9me2/3 binding of the MBT domain protein LIN-61 is essential for Caenorhabditis elegans vulva development.
PLoS Genet 2011 7(3) e1002017 
[ PubMed ID = 21437264 ] [ RRC reference ]

Black JC, Allen A, Van Rechem C, Forbes E, Longworth M, Tschöp K, Rinehart C, Quiton J, Walsh R, Smallwood A, Dyson NJ, Whetstine JR.
Conserved antagonism between JMJD2A/KDM4A and HP1γ during cell cycle progression.
Mol Cell 2010 40(5) 736-48 
[ PubMed ID = 21145482 ] [ RRC reference ]

Hall SE, Beverly M, Russ C, Nusbaum C, Sengupta P.
A cellular memory of developmental history generates phenotypic diversity in C. elegans.
Curr Biol 2010 20(2) 149-55 
[ PubMed ID = 20079644 ] [ RRC reference ]

Luijsterburg MS, Dinant C, Lans H, Stap J, Wiernasz E, Lagerwerf S, Warmerdam DO, Lindh M, Brink MC, Dobrucki JW, Aten JA, Fousteri MI, Jansen G, Dantuma NP, Vermeulen W, Mullenders LH, Houtsmuller AB, Verschure PJ, van Driel R.
Heterochromatin protein 1 is recruited to various types of DNA damage.
J Cell Biol 2009 185(4) 577-86 
[ PubMed ID = 19451271 ] [ RRC reference ]

Simonet T, Dulermo R, Schott S, Palladino F.
Antagonistic functions of SET-2/SET1 and HPL/HP1 proteins in C. elegans development.
Dev Biol 2007 312(1) 367-83 
[ PubMed ID = 17967446 ] [ RRC reference ]

Schott S, Coustham V, Simonet T, Bedet C, Palladino F.
Unique and redundant functions of C. elegans HP1 proteins in post-embryonic development.
Dev Biol 2006 298(1) 176-87 
[ PubMed ID = 16905130 ] [ RRC reference ]

Grote P, Conradt B.
The PLZF-like protein TRA-4 cooperates with the Gli-like transcription factor TRA-1 to promote female development in C. elegans.
Dev Cell 2006 11(4) 561-73 
[ PubMed ID = 17011494 ] [ RRC reference ]