分離済み変異体

tm1620

Allele Name

tm1620

Allele Type

通常株

Sequence Name

B0280.10

Gene Name

pot-1

Worm Base

Allele Name

tm1620

Gene Name

pot-1

Sequence

B0280.10

Phenotype

homozygous viable. Dr. J. Lee: increased telomere length.

Mutation site

30598/30599-31354/31355 (756 bp deletion)

Chromosome

III

Putative gene structure

complement(join(30101..30220, 30273..30365, 30415..30503, 30558..30706, 30852..30994, 31039..31119, 31177..31274, 31321..31468, 31515..31631))

Map position

-0.79

Balancer

Map position of balancer

Sequence of primers

IntRev:CACACCAATAAATTCCGCTC,ExtRev:TTCCGACAGCCAAGTACGTA,IntFwd:TGGCTAGGATTCGTACCTGA,ExtFwd:AACGGAACACTACCAACCCT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Dietz S, Almeida MV, Nischwitz E, Schreier J, Viceconte N, Fradera-Sola A, Renz C, Ceron-Noriega A, Ulrich HD, Kappei D, Ketting RF, Butter F.
The double-stranded DNA-binding proteins TEBP-1 and TEBP-2 form a telomeric complex with POT-1.
Nat Commun 2021 12(1) 2668
[ PubMed ID = 33976151 ] [ RRC reference ]

Lister-Shimauchi EH, Dinh M, Maddox P, Ahmed S.
Gametes deficient for Pot1 telomere binding proteins alter levels of telomeric foci for multiple generations.
Commun Biol 2021 4(1) 158
[ PubMed ID = 33542458 ] [ RRC reference ]

Seo B, Kim C, Hills M, Sung S, Kim H, Kim E, Lim DS, Oh HS, Choi RMJ, Chun J, Shim J, Lee J.
Telomere maintenance through recruitment of internal genomic regions.
Nat Commun 2015 6 8189
[ PubMed ID = 26382656 ] [ RRC reference ]

Shtessel L, Lowden MR, Cheng C, Simon M, Wang K, Ahmed S.
Caenorhabditis elegans POT-1 and POT-2 repress telomere maintenance pathways.
G3 (Bethesda) 2013 3(2) 305-13
[ PubMed ID = 23390606 ] [ RRC reference ]

Lackner DH, Raices M, Maruyama H, Haggblom C, Karlseder J.
Organismal propagation in the absence of a functional telomerase pathway in Caenorhabditis elegans.
EMBO J 2012 31(8) 2024-33
[ PubMed ID = 22425786 ] [ RRC reference ]

Cheng C, Shtessel L, Brady MM, Ahmed S.
Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths.
Proc Natl Acad Sci U S A 2012 109(20) 7805-10
[ PubMed ID = 22547822 ] [ RRC reference ]

Ferreira HC, Towbin BD, Jegou T, Gasser SM.
The shelterin protein POT-1 anchors Caenorhabditis elegans telomeres through SUN-1 at the nuclear periphery.
J Cell Biol 2013 203(5) 727-35
[ PubMed ID = 24297748 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54
[ PubMed ID = 18780750 ] [ RRC reference ]

Raices M, Verdun RE, Compton SA, Haggblom CI, Griffith JD, Dillin A, Karlseder J.
C. elegans telomeres contain G-strand and C-strand overhangs that are bound by distinct proteins.
Cell 2008 132(5) 745-57
[ PubMed ID = 18329362 ] [ RRC reference ]