Allele Name | tm1615 |
Allele Type | バランス済 |
Sequence Name | F08B4.1 |
Gene Name | dic-1 |
Worm Base | Allele Name |
tm1615
|
Gene Name |
dic-1
|
Sequence |
F08B4.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. H-S. Koo: larval arrest at the L3 stage.Development 133, 3597 (2006) |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 32904/32905-33492/33493 (588 bp deletion) |
Chromosome | IV |
Putative gene structure | join(31989..32099, 32146..32241, 32357..32674, 32734..32950, 33042..33204, 33285..33453, 33544..33765, 33844..34032, 34083..34205, 34248..34348, 34724..34840, 35115..35562, 35691..35787, 35845..35993) |
Map position | 3.94 |
Balancer | nT1 [qIs51] |
Map position of balancer | |
Sequence of primers | ExtFwd:GCGTACTTTGTAGCGAACCT,IntFwd:GCGAACCTGACGCGCAATAA,ExtRev:GGCGATAGCCATTTGATCTA,IntRev:GGTCCATTTGATGAACCTTC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Beltran T, Pahita E, Ghosh S, Lenhard B, Sarkies P. Integrator is recruited to promoter-proximally paused RNA Pol II to generate Caenorhabditis elegans piRNA precursors. EMBO J 2021 40(5) e105564
[ PubMed ID = 33340372 ]
[ RRC reference ]
|
Gómez-Orte E, Sáenz-Narciso B, Zheleva A, Ezcurra B, de Toro M, López R, Gastaca I, Nilsen H, Sacristán MP, Schnabel R, Cabello J. Disruption of the Caenorhabditis elegans Integrator complex triggers a non-conventional transcriptional mechanism beyond snRNA genes. PLoS Genet 2019 15(2) e1007981
[ PubMed ID = 30807579 ]
[ RRC reference ]
|
Bustos AVG, Jiménez MG, Mora RMS. The Annona muricata leaf ethanol extract affects mobility and reproduction in mutant strain NB327 Caenorhabditis elegans. Biochem Biophys Rep 2017 10 282-286
[ PubMed ID = 28955756 ]
[ RRC reference ]
|
Han SM, Lee TH, Mun JY, Kim MJ, Kritikou EA, Lee SJ, Han SS, Hengartner MO, Koo HS. Deleted in cancer 1 (DICE1) is an essential protein controlling the topology of the inner mitochondrial membrane in C. elegans. Development 2006 133(18) 3597-606
[ PubMed ID = 16914495 ]
[ RRC reference ]
|
|