| Allele Name | tm1611 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C49F5.2 |
| Gene Name | set-6 |
| Worm Base | Allele Name |
tm1611
|
| Gene Name |
set-6
|
| Sequence |
C49F5.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. R.H. Horvitz: Development 134, 2991 (2007). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15127/15128-15845/15846 (718 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(11611..11838, 11905..12024, 12559..13110, 13163..13294, 13825..14077, 14125..14432, 14578..14682, 14797..14898, 15474..15569, 15668..15811, 15894..15980)) |
| Map position | 6.84 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GGCCAGACATCGAACAGCCA,IntFwd:ATAAACAGAGCTCTCGTGCT,ExtRev:CGCTCCTCTCACATTTGTCA,IntRev:CTGTTAGTACGTCTGCTCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Leight ER, Murphy JT, Fantz DA, Pepin D, Schneider DL, Ratliff TM, Mohammad DH, Herman MA, Kornfeld K.
Conversion of the LIN-1 ETS protein of Caenorhabditis elegans from a SUMOylated transcriptional repressor to a phosphorylated transcriptional activator.
Genetics 2015 199(3) 761-75
[ PubMed ID = 25567989 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.