| Allele Name | tm1605 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K11E8.1 |
| Gene Name | unc-43 |
| Worm Base | Allele Name |
tm1605
|
| Gene Name |
unc-43
|
| Sequence |
K11E8.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15890/15891-16541/16542 (651 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement((join(AL023841.1:237..295, 16829..17038, 16713..16778, 16342..16414, 15970..16153, 15827..15921, 15653..15775, 15488..15571, 11979..12025, 9611..9729, 6952..7050, 5457..5570, 4424..4499, 4129..4220, 3825..3933, 2851..2980)) |
| Map position | 4.57 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GCAGTCAACAGTATCCTGTC,IntFwd:GGATAGCTGATGCAACGCGT,ExtRev:ATAACTCGCGCGAGGCAGAG,IntRev:TGGGAAAGATGCTCACGTAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Roussos A, Kitopoulou K, Borbolis F, Ploumi C, Gianniou DD, Li Z, He H, Tsakiri E, Borland H, Kostakis IK, Samiotaki M, Trougakos IP, Bohr VA, Palikaras K.
Urolithin Α modulates inter-organellar communication via calcium-dependent mitophagy to promote healthy ageing.
Autophagy 2025 21(12) 3097-3122
[ PubMed ID = 40944367 ]
[ RRC reference ]
|
Petratou D, Gjikolaj M, Kaulich E, Schafer W, Tavernarakis N.
A proton-inhibited DEG/ENaC ion channel maintains neuronal ionstasis and promotes neuronal survival under stress.
iScience 2023 26(7) 107117
[ PubMed ID = 37416472 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.