分離済み変異体

tm1598

Allele Nametm1598
BalanceCompleted
OutCrossNot Accepted
Sequence NameY75B8A.30
Gene Namepph-4.1
Worm BaseAllele Name tm1598 (x1)
Gene Name pph-4.1
Sequence Y75B8A.30
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. K.F. O'Connell: Emb.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 281751/281752-282266/282267 (515 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(276460..276589, 279275..279516, 281408..281686, 281762..281887, 281946..282069, 282125..282225))
Map position16.78
Balancer,eT1[nIs267]
Map position of balancer
Sequence of primersExtRev:GAGTCTACGAGCCCATTGTC,IntRev:CGCTTCCGTGGATCAATACT,IntFwd:TAGTACTAATCGACGGGGAT,ExtFwd:CCTGCTTCCGATCAATAACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guo H, Stamper EL, Sato-Carlton A, Shimazoe MA, Li X, Zhang L, Stevens L, Tam KCJ, Dernburg AF, Carlton PM.
Phosphoregulation of DSB-1 mediates control of meiotic double-strand break activity.
Elife 2022 11  
[ PubMed ID = 35758641 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Li X, Boog H, Lehmer MK, Rosenberg SC, Barroso C, Martinez-Perez E, Corbett KD, Carlton PM.
Phosphoregulation of HORMA domain protein HIM-3 promotes asymmetric synaptonemal complex disassembly in meiotic prophase in Caenorhabditis elegans.
PLoS Genet 2020 16(11) e1008968 
[ PubMed ID = 33175901 ] [ RRC reference ]

Sato-Carlton A, Li X, Crawley O, Testori S, Martinez-Perez E, Sugimoto A, Carlton PM.
Protein phosphatase 4 promotes chromosome pairing and synapsis, and contributes to maintaining crossover competence with increasing age.
PLoS Genet 2014 10(10) e1004638 
[ PubMed ID = 25340746 ] [ RRC reference ]

Peters N, Perez DE, Song MH, Liu Y, Müller-Reichert T, Caron C, Kemphues KJ, O'Connell KF.
Control of mitotic and meiotic centriole duplication by the Plk4-related kinase ZYG-1.
J Cell Sci 2010 123(Pt 5) 795-805 
[ PubMed ID = 20144993 ] [ RRC reference ]