| Allele Name | tm1585 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C29F3.2 |
| Gene Name | wrt-8 |
| Worm Base | Allele Name |
tm1585
|
| Gene Name |
wrt-8
|
| Sequence |
C29F3.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 538/539-1825/1826 (1287 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(complement(2036..2131), complement(1591..1788), complement(1456..1544), complement(1176..1414), complement(845..1128), complement(743..796), complement(647..698), complement(421..598), complement(185..341), complement(111..136), complement(AL023813.1:3655..3793), complement(AL023813.1:3462..3602)) |
| Map position | 7.86 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CTAGCTCATCCATCCGCTTC,ExtFwd:CCTTCCCGTGTAATGCCTGA,IntRev:GGCACCCAATATGTCGAGCT,ExtRev:CGCCCGCAAGACTTGTATCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Baker EA, Gilbert SPR, Shimeld SM, Woollard A. Extensive non-redundancy in a recently duplicated developmental gene family. BMC Ecol Evol 2021 21(1) 33
[ PubMed ID = 33648446 ]
[ RRC reference ]
|
Roberts AF, Gumienny TL, Gleason RJ, Wang H, Padgett RW. Regulation of genes affecting body size and innate immunity by the DBL-1/BMP-like pathway in Caenorhabditis elegans. BMC Dev Biol 2010 10 61
[ PubMed ID = 20529267 ]
[ RRC reference ]
|
|