分離済み変異体

tm1582

Allele Name

tm1582

Balance

Not Required

OutCross

Not Accepted

Sequence Name

W01G7.5

Gene Name

lem-2

Worm Base

Allele Name

tm1582

Gene Name

lem-2

Sequence

W01G7.5

Phenotype

homozygous viable. Dr. M. Hengartner: normal sensitivity to X-radiation. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior but shows synthetic nuclear anchoring defect with emr-1 (gk119).

Mutation site

[W01G7] 32536/32537-A-[Y39G8C] 509/510 (838 bp deletion + 1 bp insertion)

Chromosome

Putative gene structure

join(32472..32612, 32669..32965, AL032634.2:99..825, AL032634.2:1671..2008)

Map position

22.36

Balancer

Map position of balancer

Sequence of primers

ExtFwd:AGGCGTCGGTACAACGTGAG,IntFwd:GGCTTTCAGCTCATCGGGCA,ExtRev:GCAGTTTTCGGGCGATGCGT,IntRev:TGCGTTGTTGTCAGCGCGTA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Chen J, Chitrakar R, Baugh LR.
DAF-18/PTEN protects LIN-35/Rb from CLP-1/CAPN-mediated cleavage to promote starvation resistance.
Life Sci Alliance 2025 8(6)
[ PubMed ID = 40199585 ] [ RRC reference ]

Català-Castro F, Ortiz-Vásquez S, Martínez-Fernández C, Pezzano F, Garcia-Cabau C, Fernández-Campo M, Sanfeliu-Cerdán N, Jiménez-Delgado S, Salvatella X, Ruprecht V, Frigeri PA, Krieg M.
Measuring age-dependent viscoelasticity of organelles, cells and organisms with time-shared optical tweezer microrheology.
Nat Nanotechnol 2025 20(3) 411-420
[ PubMed ID = 39747604 ] [ RRC reference ]

Mossadeq LE, Bellutti L, Borgne RL, Canman JC, Pintard L, Verbavatz JM, Askjaer P, Dumont J.
An interkinetic envelope surrounds chromosomes between meiosis I and II in C. elegans oocytes.
bioRxiv 2024
[ PubMed ID = 39484525 ] [ RRC reference ]

Woodruff GC, Willis JH, Johnson E, Phillips PC.
Widespread changes in gene expression accompany body size evolution in nematodes.
G3 (Bethesda) 2024 14(8)
[ PubMed ID = 38775657 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Verbeeren J, Teixeira J, Garcia SMDA.
The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism.
PLoS Genet 2023 19(12) e1011109
[ PubMed ID = 38134228 ] [ RRC reference ]

Woodruff GC, Willis JH, Johnson E, Phillips PC.
Widespread changes in gene expression accompany body size evolution in nematodes.
bioRxiv 2023
[ PubMed ID = 37961435 ] [ RRC reference ]

Barger SR, Penfield L, Bahmanyar S.
Nuclear envelope assembly relies on CHMP-7 in the absence of BAF-LEM-mediated hole closure.
J Cell Sci 2023 136(21)
[ PubMed ID = 37795681 ] [ RRC reference ]

Shankar R, Lettman MM, Whisler W, Frankel EB, Audhya A.
The ESCRT machinery directs quality control over inner nuclear membrane architecture.
Cell Rep 2022 38(3) 110263
[ PubMed ID = 35045304 ] [ RRC reference ]

AlKhaleefa A, Snider FL, Duff HJ, McGhee JD.
-Using the C. elegans lem-2 Gene to Reconstruct the Human LEMD2 Mutation Associated with Hutterite-type Cataract/Cardiomyopathy.
MicroPubl Biol 2020 2020
[ PubMed ID = 32666044 ] [ RRC reference ]

Morales-Martínez A, Dobrzynska A, Askjaer P.
Inner nuclear membrane protein LEM-2 is required for correct nuclear separation and morphology in C. elegans.
J Cell Sci 2015 128(6) 1090-6
[ PubMed ID = 25653391 ] [ RRC reference ]

Bone CR, Tapley EC, Gorjánácz M, Starr DA.
The Caenorhabditis elegans SUN protein UNC-84 interacts with lamin to transfer forces from the cytoplasm to the nucleoskeleton during nuclear migration.
Mol Biol Cell 2014 25(18) 2853-65
[ PubMed ID = 25057012 ] [ RRC reference ]

González-Aguilera C, Ikegami K, Ayuso C, de Luis A, Íñiguez M, Cabello J, Lieb JD, Askjaer P.
Genome-wide analysis links emerin to neuromuscular junction activity in Caenorhabditis elegans.
Genome Biol 2014 15(2) R21
[ PubMed ID = 24490688 ] [ RRC reference ]

Barkan R, Zahand AJ, Sharabi K, Lamm AT, Feinstein N, Haithcock E, Wilson KL, Liu J, Gruenbaum Y.
Ce-emerin and LEM-2: essential roles in Caenorhabditis elegans development, muscle function, and mitosis.
Mol Biol Cell 2012 23(4) 543-52
[ PubMed ID = 22171324 ] [ RRC reference ]

Dittrich CM, Kratz K, Sendoel A, Gruenbaum Y, Jiricny J, Hengartner MO.
LEM-3 - A LEM domain containing nuclease involved in the DNA damage response in C. elegans.
PLoS One 2012 7(2) e24555
[ PubMed ID = 22383942 ] [ RRC reference ]

Mattout A, Pike BL, Towbin BD, Bank EM, Gonzalez-Sandoval A, Stadler MB, Meister P, Gruenbaum Y, Gasser SM.
An EDMD mutation in C. elegans lamin blocks muscle-specific gene relocation and compromises muscle integrity.
Curr Biol 2011 21(19) 1603-14
[ PubMed ID = 21962710 ] [ RRC reference ]