| Allele Name | tm1579 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F32A11.2 |
| Gene Name | hpr-17 |
| Worm Base | Allele Name |
tm1579
|
| Gene Name |
hpr-17
|
| Sequence |
F32A11.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. M. Hengartner: sensitive to ionizing radiation and defective in the cell cycle arrest response and the induction of apoptosis. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 25612/25613-26350/26351 (738 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(23377..23662, 23719..23842, 23889..24075, 25192..25617, 26240..26589, 26641..26722, 26774..26863)) |
| Map position | 14.59 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TTCGAACGGGCTGCGACACA,IntFwd:CTCAGAAGTCATACTCGACA,ExtRev:CTGCGTCCGCCATTTATCTG,IntRev:CGGTGCAGGTCACCGATAGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Bailly AP, Perrin A, Serrano-Macia M, Maghames C, Leidecker O, Trauchessec H, Martinez-Chantar ML, Gartner A, Xirodimas DP. The Balance between Mono- and NEDD8-Chains Controlled by NEDP1 upon DNA Damage Is a Regulatory Module of the HSP70 ATPase Activity. Cell Rep 2019 29(1) 212-224.e8
[ PubMed ID = 31577950 ]
[ RRC reference ]
|
Cheng C, Shtessel L, Brady MM, Ahmed S. Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths. Proc Natl Acad Sci U S A 2012 109(20) 7805-10
[ PubMed ID = 22547822 ]
[ RRC reference ]
|
Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair. PLoS Genet 2010 6(7) e1001025
[ PubMed ID = 20661466 ]
[ RRC reference ]
|
Boerckel J, Walker D, Ahmed S. The Caenorhabditis elegans Rad17 homolog HPR-17 is required for telomere replication. Genetics 2007 176(1) 703-9
[ PubMed ID = 17339221 ]
[ RRC reference ]
|
|