分離済み変異体

tm1579

Allele Nametm1579
BalanceNot Required
OutCrossNot Accepted
Sequence NameF32A11.2
Gene Namehpr-17
Worm BaseAllele Name tm1579
Gene Name hpr-17
Sequence F32A11.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Hengartner: sensitive to ionizing radiation and defective in the cell cycle arrest response and the induction of apoptosis.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25612/25613-26350/26351 (738 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(23377..23662, 23719..23842, 23889..24075, 25192..25617, 26240..26589, 26641..26722, 26774..26863))
Map position14.59
Balancer
Map position of balancer
Sequence of primersExtFwd:TTCGAACGGGCTGCGACACA,IntFwd:CTCAGAAGTCATACTCGACA,ExtRev:CTGCGTCCGCCATTTATCTG,IntRev:CGGTGCAGGTCACCGATAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bailly AP, Perrin A, Serrano-Macia M, Maghames C, Leidecker O, Trauchessec H, Martinez-Chantar ML, Gartner A, Xirodimas DP.
The Balance between Mono- and NEDD8-Chains Controlled by NEDP1 upon DNA Damage Is a Regulatory Module of the HSP70 ATPase Activity.
Cell Rep 2019 29(1) 212-224.e8 
[ PubMed ID = 31577950 ] [ RRC reference ]

Cheng C, Shtessel L, Brady MM, Ahmed S.
Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths.
Proc Natl Acad Sci U S A 2012 109(20) 7805-10 
[ PubMed ID = 22547822 ] [ RRC reference ]

Bailly AP, Freeman A, Hall J, Déclais AC, Alpi A, Lilley DM, Ahmed S, Gartner A.
The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.
PLoS Genet 2010 6(7) e1001025 
[ PubMed ID = 20661466 ] [ RRC reference ]

Boerckel J, Walker D, Ahmed S.
The Caenorhabditis elegans Rad17 homolog HPR-17 is required for telomere replication.
Genetics 2007 176(1) 703-9 
[ PubMed ID = 17339221 ] [ RRC reference ]