Allele Name | tm1572 |
Allele Type | 通常株 |
Sequence Name | T27A3.1 |
Gene Name | trak-1 |
Worm Base | Allele Name |
tm1572
|
Gene Name |
trak-1
|
Sequence |
T27A3.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozyogous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 25235/25236-TTA-25941/25942 (706 bp deletion + 3 bp insertion) |
Chromosome | I |
Putative gene structure | join(23989..24083, 24521..24644, 24812..24885, 25045..25170, 25346..25405, 25737..25956, 26007..26178, 26227..26405, 26452..26622, 26669..26789, 26844..26992, 27050..27118, 27303..27443, 27809..27931) |
Map position | 0.79 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:ACGCAAGGGAGTCATAGAGA,IntFwd:CCTGGCTCTGGGAATGAATA,ExtFwd:TGGGTTGGAAACACTCTGTG,IntRev:TTAGCCATGAGCTCCGCGTA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Chen YC, Huang HR, Hsu CH, Ou CY. CRMP/UNC-33 organizes microtubule bundles for KIF5-mediated mitochondrial distribution to axon. PLoS Genet 2021 17(2) e1009360
[ PubMed ID = 33571181 ]
[ RRC reference ]
|
Norflus F, Bu J, Guyton E, Gutekunst CA. Behavioral analysis of the huntingtin-associated protein 1 ortholog trak-1 in Caenorhabditis elegans. J Neurosci Res 2016 94(9) 850-6
[ PubMed ID = 27319755 ]
[ RRC reference ]
|
Yogev S, Maeder CI, Cooper R, Horowitz M, Hendricks AG, Shen K. Local inhibition of microtubule dynamics by dynein is required for neuronal cargo distribution. Nat Commun 2017 8 15063
[ PubMed ID = 28406181 ]
[ RRC reference ]
|
Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y. A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans. Front Neurosci 2017 11 263
[ PubMed ID = 28539870 ]
[ RRC reference ]
|
|