| Allele Name | tm1567 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C32F10.1 |
| Gene Name | obr-4 |
| Worm Base | Allele Name |
tm1567
|
| Gene Name |
obr-4
|
| Sequence |
C32F10.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. H. Arai: WT (brood size, embryonic lethality, larval lethality and growth rate). Dr. H.C. Korswagen: no QL migration defect or ALM/PLM polarity defects. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 25711/25712-T-26251/26252 (540 bp deletion + 1 bp insertion) |
| Chromosome | I |
| Putative gene structure | join(25186..25312, 25363..25748, 26287..26361, 27887..28008, 28176..28302, 28377..28654, 28727..28925, 29271..29779, 29840..29939, 29990..30097) |
| Map position | 0.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGGTATTGGAGGCCAAACAC,IntFwd:TCACACCTCCCGCGCGTATT,ExtRev:GGACCCCAGTCAAGGGTAAT,IntRev:AGGTATTTCATCCGTACGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Kim KW, Tang NH, Piggott CA, Andrusiak MG, Park S, Zhu M, Kurup N, Cherra SJ 3rd, Wu Z, Chisholm AD, Jin Y. Expanded genetic screening in Caenorhabditis elegans identifies new regulators and an inhibitory role for NAD+ in axon regeneration. Elife 2018 7
[ PubMed ID = 30461420 ]
[ RRC reference ]
|
Kobuna H, Inoue T, Shibata M, Gengyo-Ando K, Yamamoto A, Mitani S, Arai H. Multivesicular body formation requires OSBP-related proteins and cholesterol. PLoS Genet 2010 6(8)
[ PubMed ID = 20700434 ]
[ RRC reference ]
|
|