分離済み変異体

tm1556

Allele Name

tm1556

Balance

Not Required

OutCross

Not Accepted

Sequence Name

C11D9.1

Gene Name

tiam-1

Worm Base

Allele Name

tm1556

Gene Name

tiam-1

Sequence

C11D9.1

Phenotype

homozygous viable

Mutation site

1740/1741-2591/2592 (851 bp deletion)

Chromosome

Putative gene structure

join(49..389, 940..1141, 1210..1419, 2084..2251, 2298..2414, 2462..2611, 3072..3473, 3755..3892, 3947..4067, 4125..4309)

Map position

-1.31

Balancer

Map position of balancer

Sequence of primers

IntFwd:CACCAGTCAATACCATCAGA,IntRev:GCTTTCCTAACAGTCTCCAT,ExtRev:TTCAGCCAACATTGGCTCAT,ExtFwd:GGGATCATCAATGGCATCCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Reddy AR, Machera SJ, Cook ZT, Özkan E, Shen K.
A dendritic guidance receptor functions in both ligand dependent and independent modes.
bioRxiv 2025
[ PubMed ID = 39990354 ] [ RRC reference ]

Richardson CE, Yee C, Shen K.
A hormone receptor pathway cell-autonomously delays neuron morphological aging by suppressing endocytosis.
PLoS Biol 2019 17(10) e3000452
[ PubMed ID = 31589601 ] [ RRC reference ]

Sundararajan L, Stern J, Miller DM 3rd.
Mechanisms that regulate morphogenesis of a highly branched neuron in C. elegans.
Dev Biol 2019 451(1) 53-67
[ PubMed ID = 31004567 ] [ RRC reference ]

Sundararajan L, Smith CJ, Watson JD, Millis BA, Tyska MJ, Miller DM 3rd.
Actin assembly and non-muscle myosin activity drive dendrite retraction in an UNC-6/Netrin dependent self-avoidance response.
PLoS Genet 2019 15(6) e1008228
[ PubMed ID = 31220078 ] [ RRC reference ]

Tang LT, Diaz-Balzac CA, Rahman M, Ramirez-Suarez NJ, Salzberg Y, Lázaro-Peña MI, Bülow HE.
TIAM-1/GEF can shape somatosensory dendrites independently of its GEF activity by regulating F-actin localization.
Elife 2019 8
[ PubMed ID = 30694177 ] [ RRC reference ]

Zou W, Dong X, Broederdorf TR, Shen A, Kramer DA, Shi R, Liang X, Miller DM 3rd, Xiang YK, Yasuda R, Chen B, Shen K.
A Dendritic Guidance Receptor Complex Brings Together Distinct Actin Regulators to Drive Efficient F-Actin Assembly and Branching.
Dev Cell 2018 45(3) 362-375.e3
[ PubMed ID = 29738713 ] [ RRC reference ]

Neukomm LJ, Zeng S, Frei AP, Huegli PA, Hengartner MO.
Small GTPase CDC-42 promotes apoptotic cell corpse clearance in response to PAT-2 and CED-1 in C. elegans.
Cell Death Differ 2014 21(6) 845-53
[ PubMed ID = 24632947 ] [ RRC reference ]

Demarco RS, Struckhoff EC, Lundquist EA.
The Rac GTP exchange factor TIAM-1 acts with CDC-42 and the guidance receptor UNC-40/DCC in neuronal protrusion and axon guidance.
PLoS Genet 2012 8(4) e1002665
[ PubMed ID = 22570618 ] [ RRC reference ]